Login to display prices
Login to display prices
PPM1K-protein phosphatase 1K (PP2C domain containing) Gene View larger

PPM1K-protein phosphatase 1K (PP2C domain containing) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPM1K-protein phosphatase 1K (PP2C domain containing) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPM1K-protein phosphatase 1K (PP2C domain containing) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037552
Product type: DNA & cDNA
Ncbi symbol: PPM1K
Origin species: Human
Product name: PPM1K-protein phosphatase 1K (PP2C domain containing) Gene
Size: 2ug
Accessions: BC037552
Gene id: 152926
Gene description: protein phosphatase 1K (PP2C domain containing)
Synonyms: BDP; MSUDMV; PP2Ckappa; PP2Cm; PTMP; UG0882E07; protein phosphatase 1K, mitochondrial; PP2C domain-containing protein phosphatase 1K; PP2C-kappa; PP2C-type mitochondrial phosphoprotein phosphatase; branched-chain alpha-ketoacid dehydrogenase phosphatase; protein phosphatase 2C kappa; protein phosphatase, Mg2+/Mn2+ dependent 1K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaacagctgccttaattactttggtcagaagtggtgggaaccaggtgagaaggagagtgctgctaagctcccgcctgctgcaggacgacaggcgggtgacacccacgtgccacagctccacttcagagcctaggtgttctcggtttgacccagatggtagtgggagtccagctacctgggacaattttgggatctgggataaccgcattgatgagccaattctgctgccacccagcattaagtatggcaagccaattcccaaaatcagcttggaaaaggtggggtgcgcctcacagattggcaaacggaaagagaatgaagatcggtttgacttcgctcagctgacagatgaggtcctgtactttgcagtgtatgatggacacggtggacctgcagcagctgatttctgtcatacccacatggagaaatgtattatggatttgcttcctaaggagaagaacttggaaactctgttgaccttggcttttctagaaatagataaagccttttcgagtcatgcccgcctgtctgctgatgcaactcttctgacctctgggactactgcaacagtagccctattgcgagatggtattgaactggttgtagccagtgttggggacagccgggctattttgtgtagaaaaggaaaacccatgaagctgaccattgaccatactccagaaagaaaagatgaaaaagaaaggatcaagaaatgtggtggttttgtagcttggaatagtttggggcagcctcacgtaaatggcaggcttgcaatgacaagaagtattggagatttggaccttaagaccagtggtgtcatagcagaacctgaaactaagaggattaagttacatcatgctgatgacagcttcctggtcctcaccacagatggaattaacttcatggtgaatagtcaagagatttgtgactttgtcaatcagtgccatgatcccaacgaagcagcccatgcggtgactgaacaggcaatacagtacggtactgaggataacagtactgcagtagtagtgccttttggtgcctggggaaaatataagaactctgaaatcaacttctcattcagcagaagctttgcctccagtggacgatgggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 1-acylglycerol-3-phosphate O-acyltransferase 3
- eukaryotic translation initiation factor 2C, 2
- nuclear receptor subfamily 2, group E, member 1
- calcium/calmodulin-dependent protein kinase ID