Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EIF2C2-eukaryotic translation initiation factor 2C, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF2C2-eukaryotic translation initiation factor 2C, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007633 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF2C2 |
| Origin species: | Human |
| Product name: | EIF2C2-eukaryotic translation initiation factor 2C, 2 Gene |
| Size: | 2ug |
| Accessions: | BC007633 |
| Gene id: | 27161 |
| Gene description: | eukaryotic translation initiation factor 2C, 2 |
| Synonyms: | EIF2C2; Q10; protein argonaute-2; CTA-204B4.6; PAZ Piwi domain protein; PPD; argonaute 2; argonaute RISC catalytic component 2; argonaute2; eIF-2C 2; eIF2C 2; eukaryotic translation initiation factor 2C, 2; hAgo2; protein slicer; argonaute 2, RISC catalytic component |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatccagggccagccgtgcttctgcaaatacgcgcagggggcggacagcgtggagcccatgttccggcacctgaagaacacgtatgcgggcctgcagctggtggtggtcatcctgcccggcaagacgcccgtgtacgccgaggtcaagcgcgtgggagacacggtgctggggatggccacgcagtgcgtgcagatgaagaacgtgcagaggaccacgccacagaccctgtccaacctctgcctgaagatcaacgtcaagctgggaggcgtgaacaacatcctgctgccccagggcaggccgccggtgttccagcagcccgtcatctttctgggagcagacgtcactcacccccccgccggggatgggaagaagccctccattgccgccgtggtgggcagcatggacgcccaccccaatcgctactgcgccaccgtgcgcgtgcagcagcaccggcaggagatcatacaagacctggccgccatggtccgcgagctcctcatccagttctacaagtccacgcgcttcaagcccacccgcatcatcttctaccgcgacggtgtctctgaaggccagttccagcaggttctccaccacgagttgctggccatccgtgaggcctgtatcaagctagaaaaagactaccagcccgggatcaccttcatcgtggtgcagaagaggcaccacacccggctcttctgcactgacaagaacgagcgggttgggaaaagtggaaacattccagcaggcacgactgtggacacgaaaatcacccaccccaccgagttcgacttctacctgtgtagtcacgctggcatccaggggacaagcaggccttcgcactatcacgtcctctgggacgacaatcgtttctcctctgatgagctgcagatcctaacctaccagctgtgtcacacctacgtgcgctgcacacgctccgtgtccatcccagcgccagcatactacgctcacctggtggccttccgggccaggtaccacctggtggataaggaacatgacagtgctgaaggaagccatacctctgggcagagtaacgggcgagaccaccaagcactggccaaggcggtccaggttcaccaagacactctgcgcaccatgtactttgcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear receptor subfamily 2, group E, member 1 - calcium/calmodulin-dependent protein kinase ID - nuclear receptor subfamily 1, group H, member 3 - caspase 9, apoptosis-related cysteine peptidase |