Login to display prices
Login to display prices
MCCC2-methylcrotonoyl-Coenzyme A carboxylase 2 (beta) Gene View larger

MCCC2-methylcrotonoyl-Coenzyme A carboxylase 2 (beta) Gene

PTXBC014897

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCCC2-methylcrotonoyl-Coenzyme A carboxylase 2 (beta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MCCC2-methylcrotonoyl-Coenzyme A carboxylase 2 (beta) Gene

Proteogenix catalog: PTXBC014897
Ncbi symbol: MCCC2
Product name: MCCC2-methylcrotonoyl-Coenzyme A carboxylase 2 (beta) Gene
Size: 2ug
Accessions: BC014897
Gene id: 64087
Gene description: methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
Synonyms: MCCB; methylcrotonoyl-CoA carboxylase beta chain, mitochondrial; 3-methylcrotonyl-CoA carboxylase 2; 3-methylcrotonyl-CoA carboxylase non-biotin-containing subunit; 3-methylcrotonyl-CoA:carbon dioxide ligase subunit beta; MCCase subunit beta; biotin carboxylase; methylcrotonoyl-CoA carboxylase 2 (beta); methylcrotonoyl-Coenzyme A carboxylase 2 (beta); non-biotin containing subunit of 3-methylcrotonyl-CoA carboxylase; testicular secretory protein Li 29; methylcrotonoyl-CoA carboxylase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggccgtcctgaggttagccctgcggccgtgtgcccgcgcctctcccgccgggccgcgcgcctatcacggggactcggtggcctcgctgggcacccagccggacttgggctctgccctctaccaggagaactacaagcagatgaaagcactagtaaatcagctccatgaacgagtggagcatataaaactaggaggtggtgagaaagcccgagcacttcacatatcaagaggaaaactattgcccagagaaagaattgacaatctcatagacccagggtctccatttctggaattatcccagtttgcaggttaccagttatatgacaatgaggaggtgccaggaggtggcattattacaggcattggaagagtatcaggagtagaatgcatgattattgccaatgatgccaccgtcaaaggaggtgcctactacccagtgactgtgaaaaaacaattacgggcccaagaaattgccatgcaaaacaggctcccctgcatctacttagttgattcgggaggagcatacttacctcgacaagcagatgtgtttccagatcgagaccactttggccgtacattctataatcaggcaattatgtcttctaaaaatattgcacaggttaaagcggcaactggggaagaagtatctgctgaggatcttggaggtgctgatcttcattgcagaaagtctggagtaagtgaccactgggctttggatgatcatcatgcccttcacttaactaggaaggttgtgaggaatctaaattatcagaagaaattggatgtcaccattgaaccttctgaagagcctttatttcctgctgatgaattgtatggaatagttggtgctaaccttaagaggagctttgatgtccgagaggtcattgctagaatcgtggatggaagcagattcactgagttcaaagccttttatggagacacattagttacaggtataaagcccttggaaaagcacaagacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: