Login to display prices
Login to display prices
RCN1-reticulocalbin 1, EF-hand calcium binding domain Gene View larger

RCN1-reticulocalbin 1, EF-hand calcium binding domain Gene

PTXBC010120

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCN1-reticulocalbin 1, EF-hand calcium binding domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RCN1-reticulocalbin 1, EF-hand calcium binding domain Gene

Proteogenix catalog: PTXBC010120
Ncbi symbol: RCN1
Product name: RCN1-reticulocalbin 1, EF-hand calcium binding domain Gene
Size: 2ug
Accessions: BC010120
Gene id: 5954
Gene description: reticulocalbin 1, EF-hand calcium binding domain
Synonyms: HEL-S-84; PIG20; RCAL; RCN; reticulocalbin-1; epididymis secretory protein Li 84; proliferation-inducing gene 20; reticulocalbin 1, EF-hand calcium binding domain; reticulocalbin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcgcggtggccgcggccgccgcctggggttagccctggggctgctgctggcgctggtgctggcgccgcgggttctgcgggccaagcccacggtgcgcaaagagcgcgtggtgcggcccgactcggagctgggcgagcggccccctgaggacaaccagagcttccagtacgaccacgaggccttcctgggcaaggaggactccaagaccttcgaccagctcaccccggacgagagcaaggagaggctagggaagattgttgatcgaatcgacaatgatggggatggctttgtcactactgaggagctgaaaacctggatcaaacgggtgcagaaaagatacatctttgataatgtcgccaaagtctggaaggattatgatagggacaaggatgataaaatttcctgggaagaatacaaacaagccacctatggttactacctaggaaaccccgcagagtttcatgattcttcagatcatcacacctttaaaaagatgctgccacgtgatgagagaagattcaaagctgcagacctcaatggtgacctgacagctactcgggaggagttcactgcctttctgcatcctgaagagtttgaacatatgaaggaaattgtggttttggaaaccctggaggacatcgacaagaacggggatgggtttgtggatcaggatgagtatattgcggatatgttttcccatgaggagaatggccctgagccagactgggttttatcagaacgggagcagtttaacgaattccgggatctgaacaaggacgggaagttagacaaagatgagattcgccactggatcctccctcaagattatgatcatgcacaggctgaggccaggcatctggtatatgaatcagacaaaaacaaggatgagaagctaactaaagaggaaatattggagaactggaacatgtttgtcggaagccaagctaccaattacggggaagatctcacaaaaaatcatgatgagctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: