Login to display prices
Login to display prices
RCN3-reticulocalbin 3, EF-hand calcium binding domain Gene View larger

RCN3-reticulocalbin 3, EF-hand calcium binding domain Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCN3-reticulocalbin 3, EF-hand calcium binding domain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RCN3-reticulocalbin 3, EF-hand calcium binding domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013436
Product type: DNA & cDNA
Ncbi symbol: RCN3
Origin species: Human
Product name: RCN3-reticulocalbin 3, EF-hand calcium binding domain Gene
Size: 2ug
Accessions: BC013436
Gene id: 57333
Gene description: reticulocalbin 3, EF-hand calcium binding domain
Synonyms: RLP49; reticulocalbin-3; EF-hand calcium-binding protein RLP49; reticulocabin; reticulocalbin 3, EF-hand calcium binding domain; reticulocalbin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtggcgaccatcagttctgctgcttctgttgctactgaggcacggggcccaggggaagccatccccagacgcaggccctcatggccaggggagggtgcaccaggcggcccccctgagcgacgctccccatgatgacgcccacgggaacttccagtacgaccatgaggctttcctgggacgggaagtggccaaggaattcgaccaactcaccccagaggaaagccaggcccgtctggggcggatcgtggaccgcatggaccgcgcgggggacggcgacggctgggtgtcgctggccgagcttcgcgcgtggatcgcgcacacgcagcagcggcacatacgggactcggtgagcgcggcctgggacacgtacgacacggaccgcgacgggcgtgtgggttgggaggagctgcgcaacgccacctatggccactacgcgcccggtgaagaatttcatgacgtggaggatgcagagacctacaaaaagatgctggctcgggacgagcggcgtttccgggtggccgaccaggatggggactcgatggccactcgagaggagctgacagccttcctgcaccccgaggagttccctcacatgcgggacatcgtgattgctgaaaccctggaggacctggacagaaacaaagatggctatgtccaggtggaggagtacatcgcggatctgtactcagccgagcctggggaggaggagccggcgtgggtgcagacggagaggcagcagttccgggacttccgggatctgaacaaggatgggcacctggatgggagtgaggtgggccactgggtgctgccccctgcccaggaccagcccctggtggaagccaaccacctgctgcacgagagcgacacggacaaggatgggcggctgagcaaagcggaaatcctgggtaattggaacatgtttgtgggcagtcaggccaccaactatggcgaggacctgacccggcaccacgatgagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
- reticulocalbin 1, EF-hand calcium binding domain
- EP300 interacting inhibitor of differentiation 3
- aspartate beta-hydroxylase domain containing 2