BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene View larger

BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002461
Product type: DNA & cDNA
Ncbi symbol: BNIP2
Origin species: Human
Product name: BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene
Size: 2ug
Accessions: BC002461
Gene id: 663
Gene description: BCL2/adenovirus E1B 19kDa interacting protein 2
Synonyms: BNIP-2; NIP2; BCL2/adenovirus E1B 19 kDa protein-interacting protein 2; BCL2/adenovirus E1B 19kDa interacting protein 2; BCL2 interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggtgtggaacttaaagaagaatggcaagatgaagattttccgatacctttaccagaagatgatagtattgaagcagatatactagctataactggaccagaggaccagcctggctcactagaagttaatggaaataaagtgagaaagaaactaatggctccagacattagcctgacactggatcctagtgatggctctgtattgtcagatgatttggatgaaagtggggagattgacttagatggcttagacacaccgtcagagaatagtaatgagtttgagtgggaagatgatcttccaaaacccaagactactgaagtaattaggaaaggctcaattactgaatacacagcagcagaggaaaaagaagatggacgacgctggcgtatgttcaggattggagaacaggaccacagggttgatatgaaggcaattgaaccctataaaaaagttatcagccatgggggatattatggggatggattaaatgccattgttgtgtttgctgtctgtttcatgcctgaaagtagtcagcctaactatagatacctgatggacaatctttttaaatatgttattggcactttggagctattagtagcagaaaactacatgatagtttatttaaatggtgcaacaactcgaagaaaaatgcccagtctgggatggctcaggaaatgttatcagcaaattgatagaaggttacggaaaaatctaaaatccctaatcattgtacatccttcttggtttatcagaacacttctggctgttacaagaccatttattagctcgaaattcagccaaaaaattagatacgtgtttaatttggcagaactagcagaacttgtccccatggaatacgttggcataccagaatgcataaaacaagttgatcaagaacttaatggaaaacaagatgaaccgaaaaatgaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - corticotropin releasing hormone binding protein
- family with sequence similarity 164, member A
- dehydrogenase/reductase (SDR family) member 7B
- reticulocalbin 3, EF-hand calcium binding domain

Buy BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene now

Add to cart