Login to display prices
Login to display prices
BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene View larger

BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene

PTXBC002461

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene

Proteogenix catalog: PTXBC002461
Ncbi symbol: BNIP2
Product name: BNIP2-BCL2/adenovirus E1B 19kDa interacting protein 2 Gene
Size: 2ug
Accessions: BC002461
Gene id: 663
Gene description: BCL2/adenovirus E1B 19kDa interacting protein 2
Synonyms: BNIP-2; NIP2; BCL2/adenovirus E1B 19 kDa protein-interacting protein 2; BCL2/adenovirus E1B 19kDa interacting protein 2; BCL2 interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggtgtggaacttaaagaagaatggcaagatgaagattttccgatacctttaccagaagatgatagtattgaagcagatatactagctataactggaccagaggaccagcctggctcactagaagttaatggaaataaagtgagaaagaaactaatggctccagacattagcctgacactggatcctagtgatggctctgtattgtcagatgatttggatgaaagtggggagattgacttagatggcttagacacaccgtcagagaatagtaatgagtttgagtgggaagatgatcttccaaaacccaagactactgaagtaattaggaaaggctcaattactgaatacacagcagcagaggaaaaagaagatggacgacgctggcgtatgttcaggattggagaacaggaccacagggttgatatgaaggcaattgaaccctataaaaaagttatcagccatgggggatattatggggatggattaaatgccattgttgtgtttgctgtctgtttcatgcctgaaagtagtcagcctaactatagatacctgatggacaatctttttaaatatgttattggcactttggagctattagtagcagaaaactacatgatagtttatttaaatggtgcaacaactcgaagaaaaatgcccagtctgggatggctcaggaaatgttatcagcaaattgatagaaggttacggaaaaatctaaaatccctaatcattgtacatccttcttggtttatcagaacacttctggctgttacaagaccatttattagctcgaaattcagccaaaaaattagatacgtgtttaatttggcagaactagcagaacttgtccccatggaatacgttggcataccagaatgcataaaacaagttgatcaagaacttaatggaaaacaagatgaaccgaaaaatgaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: