Login to display prices
Login to display prices
CASP7-caspase 7, apoptosis-related cysteine peptidase Gene View larger

CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

PTXBC015799

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

Proteogenix catalog: PTXBC015799
Ncbi symbol: CASP7
Product name: CASP7-caspase 7, apoptosis-related cysteine peptidase Gene
Size: 2ug
Accessions: BC015799
Gene id: 840
Gene description: caspase 7, apoptosis-related cysteine peptidase
Synonyms: CASP-7; CMH-1; ICE-LAP3; LICE2; MCH3; ICE-like apoptotic protease 3; apoptotic protease MCH-3; caspase 7, apoptosis-related cysteine peptidase; caspase 7, apoptosis-related cysteine protease; caspase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagatgagcagggctgtattgaagagcagggggttgaggattcagcaaatgaagattcagtggatgctaagccagaccggtcctcgtttgtaccgtccctcttcagtaagaagaagaaaaatgtcaccatgcgatccatcaagaccacccgggaccgagtgcctacatatcagtacaacatgaattttgaaaagctgggcaaatgcatcataataaacaacaagaactttgataaagtgacaggtatgggcgttcgaaacggaacagacaaagatgccgaggcgctcttcaagtgcttccgaagcctgggttttgacgtgattgtctataatgactgctcttgtgccaagatgcaagatctgcttaaaaaagcttctgaagaggaccatacaaatgccgcctgcttcgcctgcatcctcttaagccatggagaagaaaatgtaatttatgggaaagatggtgtcacaccaataaaggatttgacagcccactttaggggggatagatgcaaaacccttttagagaaacccaaactcttcttcattcaggcttgccgagggaccgagcttgatgatggcatccaggccgactcggggcccatcaatgacacagatgctaatcctcgatacaagatcccagtggaagctgacttcctcttcgcctattccacggttccaggctattactcgtggaggagcccaggaagaggctcctggtttgtgcaagccctctgctccatcctggaggagcacggaaaagacctggaaatcatgcagatcctcaccagggtgaatgacagagttgccaggcactttgagtctcagtctgatgacccacacttccatgagaagaagcagatcccctgtgtggtctccatgctcaccaaggaactctacttcagtcaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: