CASP7-caspase 7, apoptosis-related cysteine peptidase Gene View larger

CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

PTXBC015799

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CASP7-caspase 7, apoptosis-related cysteine peptidase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015799
Product type: DNA & cDNA
Ncbi symbol: CASP7
Origin species: Human
Product name: CASP7-caspase 7, apoptosis-related cysteine peptidase Gene
Size: 2ug
Accessions: BC015799
Gene id: 840
Gene description: caspase 7, apoptosis-related cysteine peptidase
Synonyms: CASP-7; CMH-1; ICE-LAP3; LICE2; MCH3; ICE-like apoptotic protease 3; apoptotic protease MCH-3; caspase 7, apoptosis-related cysteine peptidase; caspase 7, apoptosis-related cysteine protease; caspase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagatgagcagggctgtattgaagagcagggggttgaggattcagcaaatgaagattcagtggatgctaagccagaccggtcctcgtttgtaccgtccctcttcagtaagaagaagaaaaatgtcaccatgcgatccatcaagaccacccgggaccgagtgcctacatatcagtacaacatgaattttgaaaagctgggcaaatgcatcataataaacaacaagaactttgataaagtgacaggtatgggcgttcgaaacggaacagacaaagatgccgaggcgctcttcaagtgcttccgaagcctgggttttgacgtgattgtctataatgactgctcttgtgccaagatgcaagatctgcttaaaaaagcttctgaagaggaccatacaaatgccgcctgcttcgcctgcatcctcttaagccatggagaagaaaatgtaatttatgggaaagatggtgtcacaccaataaaggatttgacagcccactttaggggggatagatgcaaaacccttttagagaaacccaaactcttcttcattcaggcttgccgagggaccgagcttgatgatggcatccaggccgactcggggcccatcaatgacacagatgctaatcctcgatacaagatcccagtggaagctgacttcctcttcgcctattccacggttccaggctattactcgtggaggagcccaggaagaggctcctggtttgtgcaagccctctgctccatcctggaggagcacggaaaagacctggaaatcatgcagatcctcaccagggtgaatgacagagttgccaggcactttgagtctcagtctgatgacccacacttccatgagaagaagcagatcccctgtgtggtctccatgctcaccaaggaactctacttcagtcaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-crk sarcoma virus CT10 oncogene homolog (avian)
- aldo-keto reductase family 1, member C-like 2
- family with sequence similarity 175, member B
- family with sequence similarity 113, member A

Buy CASP7-caspase 7, apoptosis-related cysteine peptidase Gene now

Add to cart