Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CASP7-caspase 7, apoptosis-related cysteine peptidase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CASP7-caspase 7, apoptosis-related cysteine peptidase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015799 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CASP7 |
| Origin species: | Human |
| Product name: | CASP7-caspase 7, apoptosis-related cysteine peptidase Gene |
| Size: | 2ug |
| Accessions: | BC015799 |
| Gene id: | 840 |
| Gene description: | caspase 7, apoptosis-related cysteine peptidase |
| Synonyms: | CASP-7; CMH-1; ICE-LAP3; LICE2; MCH3; ICE-like apoptotic protease 3; apoptotic protease MCH-3; caspase 7, apoptosis-related cysteine peptidase; caspase 7, apoptosis-related cysteine protease; caspase 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagatgagcagggctgtattgaagagcagggggttgaggattcagcaaatgaagattcagtggatgctaagccagaccggtcctcgtttgtaccgtccctcttcagtaagaagaagaaaaatgtcaccatgcgatccatcaagaccacccgggaccgagtgcctacatatcagtacaacatgaattttgaaaagctgggcaaatgcatcataataaacaacaagaactttgataaagtgacaggtatgggcgttcgaaacggaacagacaaagatgccgaggcgctcttcaagtgcttccgaagcctgggttttgacgtgattgtctataatgactgctcttgtgccaagatgcaagatctgcttaaaaaagcttctgaagaggaccatacaaatgccgcctgcttcgcctgcatcctcttaagccatggagaagaaaatgtaatttatgggaaagatggtgtcacaccaataaaggatttgacagcccactttaggggggatagatgcaaaacccttttagagaaacccaaactcttcttcattcaggcttgccgagggaccgagcttgatgatggcatccaggccgactcggggcccatcaatgacacagatgctaatcctcgatacaagatcccagtggaagctgacttcctcttcgcctattccacggttccaggctattactcgtggaggagcccaggaagaggctcctggtttgtgcaagccctctgctccatcctggaggagcacggaaaagacctggaaatcatgcagatcctcaccagggtgaatgacagagttgccaggcactttgagtctcagtctgatgacccacacttccatgagaagaagcagatcccctgtgtggtctccatgctcaccaaggaactctacttcagtcaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-crk sarcoma virus CT10 oncogene homolog (avian) - aldo-keto reductase family 1, member C-like 2 - family with sequence similarity 175, member B - family with sequence similarity 113, member A |