CASP6-caspase 6, apoptosis-related cysteine peptidase Gene View larger

CASP6-caspase 6, apoptosis-related cysteine peptidase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CASP6-caspase 6, apoptosis-related cysteine peptidase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CASP6-caspase 6, apoptosis-related cysteine peptidase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000305
Product type: DNA & cDNA
Ncbi symbol: CASP6
Origin species: Human
Product name: CASP6-caspase 6, apoptosis-related cysteine peptidase Gene
Size: 2ug
Accessions: BC000305
Gene id: 839
Gene description: caspase 6, apoptosis-related cysteine peptidase
Synonyms: MCH2; apoptotic protease MCH-2; caspase 6, apoptosis-related cysteine peptidase; caspase 6, apoptosis-related cysteine protease; caspase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcggcctcggggctccgcagggggcacccggcaggtggggaagaaaacatgacagaaacagatgccttctataaaagagaaatgtttgatccggcagaaaagtacaaaatggaccacaggaggagaggaattgctttaatcttcaatcatgagaggttcttttggcacttaacactgccagaaaggcggggcacctgcgcagatagagacaatcttacccgcaggttttcagatctaggatttgaagtgaaatgctttaatgatcttaaagcagaagaactactgctcaaaattcatgaggtgtcaactgttagccacgcagatgccgattgctttgtgtgtgtcttcctgagccatggcgaaggcaatcacatttatgcatatgatgctaaaatcgaaattcagacattaactggcttgttcaaaggagacaagtgtcacagcctggttggaaaacccaagatatttatcattcaggcatgtcggggaaaccagcacgatgtgccagtcattcctttggatgtagtagataatcagacagagaagttggacaccaacataactgaggtggatgcagcctccgtttacacgctgcctgctggagctgacttcctcatgtgttactctgttgcagaaggatattattctcaccgggaaactgtgaacggctcatggtacattcaagatttgtgtgagatgttgggaaaatatggctcctccttagagttcacagaactcctcacactggtgaacaggaaagtttctcagcgccgagtggacttttgcaaagacccaagtgcaattggaaagaagcaggttccctgttttgcctcaatgctaactaaaaagctgcatttctttccaaaatctaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 105, member B
- heterogeneous nuclear ribonucleoprotein D-like
- enoyl Coenzyme A hydratase domain containing 1
- caspase 7, apoptosis-related cysteine peptidase

Buy CASP6-caspase 6, apoptosis-related cysteine peptidase Gene now

Add to cart