Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CASP3-caspase 3, apoptosis-related cysteine peptidase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CASP3-caspase 3, apoptosis-related cysteine peptidase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016926 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CASP3 |
| Origin species: | Human |
| Product name: | CASP3-caspase 3, apoptosis-related cysteine peptidase Gene |
| Size: | 2ug |
| Accessions: | BC016926 |
| Gene id: | 836 |
| Gene description: | caspase 3, apoptosis-related cysteine peptidase |
| Synonyms: | CPP32; CPP32B; SCA-1; CASP-3; CPP-32; PARP cleavage protease; SREBP cleavage activity 1; apopain; caspase 3, apoptosis-related cysteine peptidase; caspase 3, apoptosis-related cysteine protease; cysteine protease CPP32; procaspase3; protein Yama; caspase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaacactgaaaactcagtggattcaaaatccattaaaaatttggaaccaaagatcatacatggaagcgaatcaatggactctggaatatccctggacaacagttataaaatggattatcctgagatgggtttatgtataataattaataataagaattttcataaaagcactggaatgacatctcggtctggtacagatgtcgatgcagcaaacctcagggaaacattcagaaacttgaaatatgaagtcaggaataaaaatgatcttacacgtgaagaaattgtggaattgatgcgtgatgtttctaaagaagatcacagcaaaaggagcagttttgtttgtgtgcttctgagccatggtgaagaaggaataatttttggaacaaatggacctgttgacctgaaaaaaataacaaactttttcagaggggatcgttgtagaagtctaactggaaaacccaaacttttcattattcaggcctgccgtggtacagaactggactgtggcattgagacagacagtggtgttgatgatgacatggcgtgtcataaaataccagtggaggccgacttcttgtatgcatactccacagcacctggttattattcttggcgaaattcaaaggatggctcctggttcatccagtcgctttgtgccatgctgaaacagtatgccgacaagcttgaatttatgcacattcttacccgggttaaccgaaaggtggcaacagaatttgagtccttttcctttgacgctacttttcatgcaaagaaacagattccatgtattgtttccatgctcacaaaagaactctatttttatcactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 113, member B - family with sequence similarity 131, member C - family with sequence similarity 131, member A - family with sequence similarity 181, member A |