FAM18B2-family with sequence similarity 18, member B2 Gene View larger

FAM18B2-family with sequence similarity 18, member B2 Gene

PTXBC011952

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM18B2-family with sequence similarity 18, member B2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM18B2-family with sequence similarity 18, member B2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011952
Product type: DNA & cDNA
Ncbi symbol: FAM18B2
Origin species: Human
Product name: FAM18B2-family with sequence similarity 18, member B2 Gene
Size: 2ug
Accessions: BC011952
Gene id: 201158
Gene description: family with sequence similarity 18, member B2
Synonyms: protein FAM18B2; FAM18B2; Golgi apparatus membrane protein TVP23 homolog C; family with sequence similarity 18, member B2; trans-golgi network vesicle protein 23 homolog C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcagcaggatagtaatgatgacactgaagctgtttcactgtttgatgcggaagaggagacgactaatagaccaagaaaagccaaaatcagacatccagtagcatcgtttttccacttattctttcgagtcagtgcaatcatcgtctgtcttctctgtgagttgctcagcagcagctttattacctgtatggttacaattatcttgttgttgtcgtgtgacttttgggcagtgaagaatgtcacaggtagactaatggttggcctacgttggtggaatcacattgatgaagatggaaagagccattgggtgtttgaatctagaaaggagtcctctcaagagaataaaactgtgtcagaggctgaatcaagaatcttttggttgggacttattgcctgttcagtactgtgggtgatatttgcctttagtgcactcttctccttcacagtaaagtggctgagacggtctcgccacattgcccagactggtctgaaagtcttgggctcaagagatcctcccgcttccgccttccaaagcgctgggataacaggcgtgagccgctgcccgggccatccctcgagtaagtttcatcaggtagacattaattctttcacgaggatcacggatcgagctctttactggaaacctgcgccccgccttagttctccacctcttcgtgcggctccaggcaactgccaacagatggcgcccgcccgcctatttctctccttgcggctttgggcctggaggggaggtggggagagtcccaatagcagaggaactggtgagcccgggccaaaatttcatctggcatccggaatgcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD40 molecule, TNF receptor superfamily member 5
- caspase 3, apoptosis-related cysteine peptidase
- family with sequence similarity 113, member B
- family with sequence similarity 131, member C

Buy FAM18B2-family with sequence similarity 18, member B2 Gene now

Add to cart