PTXBC030643
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030643 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WBSCR28 |
| Origin species: | Human |
| Product name: | WBSCR28-Williams-Beuren syndrome chromosome region 28 Gene |
| Size: | 2ug |
| Accessions: | BC030643 |
| Gene id: | 135886 |
| Gene description: | Williams-Beuren syndrome chromosome region 28 |
| Synonyms: | Williams-Beuren syndrome chromosomal region 28 protein; Williams-Beuren syndrome critical region 28; Williams-Beuren syndrome chromosome region 28 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcccttcctccagtcagatccagccttttggggaacctgttgcaggttacgaggctctcagtgctgttggttcagaaccgagatcacctctataatttcctgctcctcaagatcaacctcttcaaccactgggtgtcagggctggcccaggaggcccgggggtcctgtaactggcaggcccacctacccctgggagctgcagactgccccctgggccaggctctccgggctgggctggctctgatacaggtccccgtatggctggtgctacagggacccaggctgatgtgggctggcatgtggggcagcaccaagggcctgggcctggccttgctcagtgcctgggagcagctgggcctgtctgtggccatctggacagatctgtttttgtcatgtctgcacggcctgatgttggtggccttgctcttggtggtagtgacctggagggtgtgtcagaagtcccactgcttccgactgggcaggcagctcagtaaggccttgcaagtgaactgcgtggtaaggaagctcctggtacagctgagacgtctgtattggtgggtggagactatgactgccctcacctcctggcacctggcctatctcatcacttggaccacctgcctggcctcccacctgctgcaggctgcctttgagcacacgacccagctggccgaggcccaggaggttgaaccccaggaggtctcagggtcttccttgctgccctcactgtctgcgtcctcggactcagagtctggaacagttttgccagagcaagaaactcccagagaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 92, member A1 - dehydrogenase/reductase (SDR family) member 12 - family with sequence similarity 164, member C - family with sequence similarity 18, member B2 |