VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene View larger

VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002911
Product type: DNA & cDNA
Ncbi symbol: VKORC1
Origin species: Human
Product name: VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene
Size: 2ug
Accessions: BC002911
Gene id: 79001
Gene description: vitamin K epoxide reductase complex, subunit 1
Synonyms: EDTP308; MST134; MST576; VKCFD2; VKOR; vitamin K epoxide reductase complex subunit 1; phylloquinone epoxide reductase; vitamin K dependent clotting factors deficiency 2; vitamin K1 2,3-epoxide reductase subunit 1; vitamin K1 epoxide reductase (warfarin-sensitive)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagcacctgggggagccctggctgggtgcggctcgctctttgcctgacgggcttagtgctctcgctctacgcgctgcacgtgaaggcggcgcgcgcccgggaccgggattaccgcgcgctctgcgacgtgggcaccgccatcagctgttcgcgcgtcttctcctccaggtggggcaggggtttcgggctggtggagcatgtgctgggacaggacagcatcctcaatcaatccaacagcatattcggttgcatcttctacacactacagctattgttaggttgcctgcggacacgctgggcctctgtcctgatgctgctgagctccctggtgtctctcgctggttctgtctacctggcctggatcctgttcttcgtgctctatgatttctgcattgtttgtatcaccacctatgctatcaacgtgagcctgatgtggctcagtttccggaaggtccaagaaccccagggcaaggctaagaggcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 176, member B
- family with sequence similarity 156, member A
- NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
- family with sequence similarity 71, member E2

Buy VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene now

Add to cart