Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002911 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VKORC1 |
| Origin species: | Human |
| Product name: | VKORC1-vitamin K epoxide reductase complex, subunit 1 Gene |
| Size: | 2ug |
| Accessions: | BC002911 |
| Gene id: | 79001 |
| Gene description: | vitamin K epoxide reductase complex, subunit 1 |
| Synonyms: | EDTP308; MST134; MST576; VKCFD2; VKOR; vitamin K epoxide reductase complex subunit 1; phylloquinone epoxide reductase; vitamin K dependent clotting factors deficiency 2; vitamin K1 2,3-epoxide reductase subunit 1; vitamin K1 epoxide reductase (warfarin-sensitive) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcagcacctgggggagccctggctgggtgcggctcgctctttgcctgacgggcttagtgctctcgctctacgcgctgcacgtgaaggcggcgcgcgcccgggaccgggattaccgcgcgctctgcgacgtgggcaccgccatcagctgttcgcgcgtcttctcctccaggtggggcaggggtttcgggctggtggagcatgtgctgggacaggacagcatcctcaatcaatccaacagcatattcggttgcatcttctacacactacagctattgttaggttgcctgcggacacgctgggcctctgtcctgatgctgctgagctccctggtgtctctcgctggttctgtctacctggcctggatcctgttcttcgtgctctatgatttctgcattgtttgtatcaccacctatgctatcaacgtgagcctgatgtggctcagtttccggaaggtccaagaaccccagggcaaggctaagaggcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 176, member B - family with sequence similarity 156, member A - NFS1 nitrogen fixation 1 homolog (S. cerevisiae) - family with sequence similarity 71, member E2 |