Login to display prices
Login to display prices
FAM156A-family with sequence similarity 156, member A Gene View larger

FAM156A-family with sequence similarity 156, member A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM156A-family with sequence similarity 156, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM156A-family with sequence similarity 156, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000867
Product type: DNA & cDNA
Ncbi symbol: FAM156A
Origin species: Human
Product name: FAM156A-family with sequence similarity 156, member A Gene
Size: 2ug
Accessions: BC000867
Gene id: 29057
Gene description: family with sequence similarity 156, member A
Synonyms: protein FAM156A; protein FAM156A/FAM156B; PRO0659; TMEM29; transmembrane protein 29; transmembrane protein 29/29B; family with sequence similarity 156 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggcctcagtaacctgagccccggtcctggccccagccaggccgtgcctctcccagaggggctgctccgccagcggtacagagaggagaagaccctggaagagcggcggtgggagaggctggagttccttcagaggaagaaagcattcctgcggcatgtgaggaggagacaccgcgatcacatggccccctatgctgttgggagggaagccagaatctccccattaggtgacagaagtcagaatcgattccgatgtgaatgtcgatactgccagagccacaggccgaatctttctgggatccctggggagagtaacagggccccacatccctcctcctgggagacgctggtgcagggcctcagtggcttgactctcagcctaggcaccaaccagcccgggcctctgcctgaagcggcactccagccacaggagacagaggagaagcgccagcgagagaggcagcaggagagcaaaataatgtttcagaggctgctcaagcagtggttagaggaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
- family with sequence similarity 71, member E2
- v-crk sarcoma virus CT10 oncogene homolog (avian)
- poly (ADP-ribose) polymerase family, member 11