FAM176B-family with sequence similarity 176, member B Gene View larger

FAM176B-family with sequence similarity 176, member B Gene

New product

462,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM176B-family with sequence similarity 176, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM176B-family with sequence similarity 176, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006241
Product type: DNA & cDNA
Ncbi symbol: FAM176B
Origin species: Human
Product name: FAM176B-family with sequence similarity 176, member B Gene
Size: 2ug
Accessions: BC006241
Gene id: 55194
Gene description: family with sequence similarity 176, member B
Synonyms: protein FAM176B; FAM176B; C1orf78; protein eva-1 homolog B; family with sequence similarity 176, member B; eva-1 homolog B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgccccgcgaagggacatggagttgctcagcaacagcctggctgcctacgcgcacatccgcgccaaccccgagagcttcggcctctacttcgtgctgggcgtctgcttcggcctgctgctcaccctctgcctgctcgtcatcagcatctcgtgggcgccccgcccgcggccccggggcccggctcagcgccgggacccccgcagcagcaccctggagcccgaggacgacgacgaggacgaggaggacacggtgactcggctgggccccgacgacacgctgccgggccccgagctgtccgcagagccggacgggcccctcaacgtcaacgtcttcacgtcggcggaggagctggagcgggcgcagcggctggaggagcgcgaacggatcctgcgggagatctggcgcaccgggcagccggacctgctgggcacaggcacgctggggcccagccccacggccacgggcaccctgggccgcatgcactattactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 156, member A
- NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
- family with sequence similarity 71, member E2
- v-crk sarcoma virus CT10 oncogene homolog (avian)

Buy FAM176B-family with sequence similarity 176, member B Gene now

Add to cart