Login to display prices
Login to display prices
MGC31957-hypothetical protein MGC31957 Gene View larger

MGC31957-hypothetical protein MGC31957 Gene

PTXBC005043

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC31957-hypothetical protein MGC31957 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC31957-hypothetical protein MGC31957 Gene

Proteogenix catalog: PTXBC005043
Ncbi symbol: MGC31957
Product name: MGC31957-hypothetical protein MGC31957 Gene
Size: 2ug
Accessions: BC005043
Gene id: 254896
Gene description: hypothetical protein MGC31957
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaaggggtgaaggagcgcttcctaccgttagggaactctggggacagagcgccccggccgcctgatggccgaggcagggtgcgacccaggacccaggacggcgtcgggaaccataccatggcccggatccccaagaccctaaagttcgtcgtcgtcatcgtcgcggtcctgctgccagtgagtccccgccgcggtccctggctggggaagagcgcacctggcgccgggagggggcagggagacggggacacggcagggatgcctggccctggtcacctgcggccgggcatgtccgggcaggacgaactcgccgtcggagtcaggggaagaactgggtccccgggctgggcaggagggacccggccgcgagggagcagagaggcggtccccctggctgccccgagcccgcgaagggagggaagttccagaatcgagagagggagggagtcaaggtggaacccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice