MGC31957-hypothetical protein MGC31957 Gene View larger

MGC31957-hypothetical protein MGC31957 Gene

PTXBC005043

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC31957-hypothetical protein MGC31957 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC31957-hypothetical protein MGC31957 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005043
Product type: DNA & cDNA
Ncbi symbol: MGC31957
Origin species: Human
Product name: MGC31957-hypothetical protein MGC31957 Gene
Size: 2ug
Accessions: BC005043
Gene id: 254896
Gene description: hypothetical protein MGC31957
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaaggggtgaaggagcgcttcctaccgttagggaactctggggacagagcgccccggccgcctgatggccgaggcagggtgcgacccaggacccaggacggcgtcgggaaccataccatggcccggatccccaagaccctaaagttcgtcgtcgtcatcgtcgcggtcctgctgccagtgagtccccgccgcggtccctggctggggaagagcgcacctggcgccgggagggggcagggagacggggacacggcagggatgcctggccctggtcacctgcggccgggcatgtccgggcaggacgaactcgccgtcggagtcaggggaagaactgggtccccgggctgggcaggagggacccggccgcgagggagcagagaggcggtccccctggctgccccgagcccgcgaagggagggaagttccagaatcgagagagggagggagtcaaggtggaacccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin, light chain 7, regulatory
- ubiquitin-conjugating enzyme E2C
- retinoblastoma binding protein 9
- hypothetical protein MGC16385

Buy MGC31957-hypothetical protein MGC31957 Gene now

Add to cart