Login to display prices
Login to display prices
KIAA1143-KIAA1143 Gene View larger

KIAA1143-KIAA1143 Gene

PTXBC008468

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1143-KIAA1143 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1143-KIAA1143 Gene

Proteogenix catalog: PTXBC008468
Ncbi symbol: KIAA1143
Product name: KIAA1143-KIAA1143 Gene
Size: 2ug
Accessions: BC008468
Gene id: 57456
Gene description: KIAA1143
Synonyms: uncharacterized protein KIAA1143
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaagcggaaccaggtatcgtacgtgcggccagccgagccggcgtttctggcccgcttcaaggaacgggtcggctacagggagggacccaccgtagagactaagagaattcagcctcagcccccagatgaagatggggatcacagtgacaaagaagatgaacagcctcaagtggtggttttaaaaaagggagacctgtcagttgaagaagtcatgaaaattaaagcagaaataaaggctgccaaagcagatgaagaaccaactccagccgatggaagaatcatatatcgaaaaccagtcaagcatccctcagatgaaaaatattcaggtttaacagcaagctcaaaaaagaagaagccaaatgaagatgaagtaaatcaggactcggtcaaaaagaactcacaaaaacaaattaaaaatagtagcctcctttcttttgacaacgaagatgaaaatgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice