Login to display prices
Login to display prices
KIAA1143-KIAA1143 Gene View larger

KIAA1143-KIAA1143 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1143-KIAA1143 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1143-KIAA1143 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008468
Product type: DNA & cDNA
Ncbi symbol: KIAA1143
Origin species: Human
Product name: KIAA1143-KIAA1143 Gene
Size: 2ug
Accessions: BC008468
Gene id: 57456
Gene description: KIAA1143
Synonyms: uncharacterized protein KIAA1143
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaagcggaaccaggtatcgtacgtgcggccagccgagccggcgtttctggcccgcttcaaggaacgggtcggctacagggagggacccaccgtagagactaagagaattcagcctcagcccccagatgaagatggggatcacagtgacaaagaagatgaacagcctcaagtggtggttttaaaaaagggagacctgtcagttgaagaagtcatgaaaattaaagcagaaataaaggctgccaaagcagatgaagaaccaactccagccgatggaagaatcatatatcgaaaaccagtcaagcatccctcagatgaaaaatattcaggtttaacagcaagctcaaaaaagaagaagccaaatgaagatgaagtaaatcaggactcggtcaaaaagaactcacaaaaacaaattaaaaatagtagcctcctttcttttgacaacgaagatgaaaatgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complexin 3
- ATP5S-like
- endothelin 2
- SAP30-like