SAP30L-SAP30-like Gene View larger

SAP30L-SAP30-like Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAP30L-SAP30-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAP30L-SAP30-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009829
Product type: DNA & cDNA
Ncbi symbol: SAP30L
Origin species: Human
Product name: SAP30L-SAP30-like Gene
Size: 2ug
Accessions: BC009829
Gene id: 79685
Gene description: SAP30-like
Synonyms: sin3 corepressor complex subunit SAP30L; histone deacetylase complex subunit SAP30L; NS4ATP2; HCV non-structural protein 4A-transactivated protein 2; Sin3A associated protein p30-like; sin3-associated protein p30-like; SAP30 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacggcttcagcacggaggaggacagccgcgaagggccccccgccgccccagctgccgccgccccgggctacggccagagctgctgcctcatcgaggacggcgagcgctgcgtccggcccgcgggcaacgcctccttcagcaagagggtccagaagagcatctcgcagaagaaactcaagctggacatcgacaagagcgtaaggcacctatatatctgtgattttcacaaaaatttcatccagagtgtccgaaataaaaggaagaggaagacaagtgacgatggcggagattctcccgagcacgacactgacattcctgaggttgatctgttccagctgcaggtgaacaccctacgacgttataaacgacactacaagttgcagaccagaccaggcttcaataaggcccagttagcagaaactgtgagtcgacacttcaggaacatacctgtgaatgaaaaagagacccttgcctacttcatctacatggtgaagagtaacaagagtagactggaccagaaatcggagggtggcaagcagcttgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glyoxalase I
- dermatopontin
- claudin 11
- endothelin 1

Buy SAP30L-SAP30-like Gene now

Add to cart