Login to display prices
Login to display prices
CLDN11-claudin 11 Gene View larger

CLDN11-claudin 11 Gene

PTXBC013577

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDN11-claudin 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLDN11-claudin 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013577
Product type: DNA & cDNA
Ncbi symbol: CLDN11
Origin species: Human
Product name: CLDN11-claudin 11 Gene
Size: 2ug
Accessions: BC013577
Gene id: 5010
Gene description: claudin 11
Synonyms: OSP; OTM; claudin-11; oligodendrocyte transmembrane protein; oligodendrocyte-specific protein; claudin 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggccacgtgcctgcaggtggtgggcttcgtcacgagcttcgtgggctggatcggggtcatcgtgaccacctccaccaatgactgggtggtgacctgcggctacaccatccccacctgccgcaagctggatgagctgggctccaaggggctgtgggccgactgcgtcatggccacggggctgtaccactgcaagcccctggtggacatcctcatcctgccgggctacgtgcaggcctgccgcgccctgatgattgctgcctcggtcctgggtctgccggccattttactgctgctgactgttcttccctgcatccggatgggccaggagcccggtgtggctaagtacaggcgggcccagctggctggtgttttgctcattctgctggctctctgcgcccttgttgccaccatctggttccctgtgtgcgcccaccgtgagaccaccatcgtgagctttggctactccctgtatgcaggctggattggtgctgtgctgtgcctcgtgggtggctgtgtcatcctctgctgcgctggagatgcccaggcctttggtgaaaaccgtttctactacactgcgggctctagctccccgactcatgcgaagagtgcccacgtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endothelin 1
- KIAA0907
- homeobox B9
- amphiregulin