Cart 35 Product Products 6 964,23 € (empty)
-
1 x FAM102A-fa...113,40 € -
-
-
1 x C7orf49-ch...113,40 € -
1 x KIAA1191-K...121,50 € -
1 x SFXN4-side...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x KIF26A-kin...113,40 € -
1 x RPL35-ribo...113,40 € -
1 x HLA-F-majo...121,50 € -
1 x HMGN3-high...113,40 € -
1 x HMGA1-high...113,40 € -
1 x NOSTRIN-ni...121,50 € -
1 x ZNF614-zin...113,40 € -
1 x NTSR2-neur...121,50 € -
1 x ABHD7-abhy...121,50 € -
-
1 x ANKRD22-an...113,40 € -
1 x CCDC51-coi...121,50 € -
1 x TSC22D4-TS...121,50 € -
1 x MKRN3-mako...113,40 € -
1 x MS4A3-memb...113,40 € -
1 x ASPA-aspar...121,50 € -
1 x COL20A1-co...113,40 € -
1 x APP-amyloi...121,50 € -
1 x NSUN5-NOL1...121,50 € -
1 x NMU-neurom...113,40 € -
1 x SLC38A1-so...121,50 € -
-
-
-
-
1 x ASS1-argin...121,50 € -
-
No products
To be determined Shipping
6 964,23 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 964,23 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 964,23 €
Data sheet of HOXB9-homeobox B9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HOXB9-homeobox B9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015565 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HOXB9 |
| Origin species: | Human |
| Product name: | HOXB9-homeobox B9 Gene |
| Size: | 2ug |
| Accessions: | BC015565 |
| Gene id: | 3219 |
| Gene description: | homeobox B9 |
| Synonyms: | HOX-2.5; HOX2; HOX2E; homeobox protein Hox-B9; homeo box 2E; homeo box B9; homeobox protein Hox-2.5; homeobox protein Hox-2E; homeobox B9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccatttctgggacgcttagcagctattatgtcgactcgatcataagtcacgagagtgaggacgcgcctccagccaagtttccttctggccagtacgcgagctcgcggcagccgggccacgcggagcacctggagttcccctcgtgcagcttccagcccaaagcgccggtgttcggcgcctcctgggcgccgctgagcccgcacgcgtccgggagcctgccgtccgtctaccacccttacatccagccccagggcgtcccgccggccgagagcaggtacctccgcacctggctggagccggcgccgcgcggcgaagcggccccggggcagggccaggcggcggtgaaggcggagccgctgctgggcgcgcctggggagctgctcaaacagggcacgcccgagtacagtttggaaacttcggcgggcagggaggccgtgctgtctaatcaaagacccggctacggggacaataaaatttgcgaaggaagcgaggacaaagagaggccggatcaaaccaacccctccgccaactggctgcacgctcgctcttcccggaaaaagcgctgtccctacaccaaataccagacgctggagctagagaaggagtttctgttcaatatgtacctcaccagggaccgtaggcacgaagtggccagactcctcaatctgagtgagagacaagtcaaaatctggtttcagaaccggcggatgaaaatgaagaaaatgaataaggagcagggcaaagagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amphiregulin - prodynorphin - homeobox A5 - homeobox A9 |