HOXB9-homeobox B9 Gene View larger

HOXB9-homeobox B9 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HOXB9-homeobox B9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HOXB9-homeobox B9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015565
Product type: DNA & cDNA
Ncbi symbol: HOXB9
Origin species: Human
Product name: HOXB9-homeobox B9 Gene
Size: 2ug
Accessions: BC015565
Gene id: 3219
Gene description: homeobox B9
Synonyms: HOX-2.5; HOX2; HOX2E; homeobox protein Hox-B9; homeo box 2E; homeo box B9; homeobox protein Hox-2.5; homeobox protein Hox-2E; homeobox B9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatttctgggacgcttagcagctattatgtcgactcgatcataagtcacgagagtgaggacgcgcctccagccaagtttccttctggccagtacgcgagctcgcggcagccgggccacgcggagcacctggagttcccctcgtgcagcttccagcccaaagcgccggtgttcggcgcctcctgggcgccgctgagcccgcacgcgtccgggagcctgccgtccgtctaccacccttacatccagccccagggcgtcccgccggccgagagcaggtacctccgcacctggctggagccggcgccgcgcggcgaagcggccccggggcagggccaggcggcggtgaaggcggagccgctgctgggcgcgcctggggagctgctcaaacagggcacgcccgagtacagtttggaaacttcggcgggcagggaggccgtgctgtctaatcaaagacccggctacggggacaataaaatttgcgaaggaagcgaggacaaagagaggccggatcaaaccaacccctccgccaactggctgcacgctcgctcttcccggaaaaagcgctgtccctacaccaaataccagacgctggagctagagaaggagtttctgttcaatatgtacctcaccagggaccgtaggcacgaagtggccagactcctcaatctgagtgagagacaagtcaaaatctggtttcagaaccggcggatgaaaatgaagaaaatgaataaggagcagggcaaagagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - amphiregulin
- prodynorphin
- homeobox A5
- homeobox A9

Buy HOXB9-homeobox B9 Gene now

Add to cart