Login to display prices
Login to display prices
PDYN-prodynorphin Gene View larger

PDYN-prodynorphin Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDYN-prodynorphin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDYN-prodynorphin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026334
Product type: DNA & cDNA
Ncbi symbol: PDYN
Origin species: Human
Product name: PDYN-prodynorphin Gene
Size: 2ug
Accessions: BC026334
Gene id: 5173
Gene description: prodynorphin
Synonyms: ADCA; PENKB; SCA23; proenkephalin-B; beta-neoendorphin-dynorphin; leu-enkephalin; leumorphin; neoendorphin-dynorphin-enkephalin prepropeptide; preprodynorphin; preproenkephalin B; rimorphin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatgggagagatgccagagctttctgtcttttttcaccccctccacccttgggctcaatgacaaggaggacttggggagcaagtcggttggggaagggccctacagtgagctggccaagctctctgggtcattcctgaaggagctggagaaaagcaagtttctcccaagtatctcaacaaaggagaacactctgagcaagagcctggaggagaagctcaggggtctctctgacgggtttagggagggagcagagtctgagctgatgagggatgcccagctgaacgatggtgccatggagactggcacactctatctcgctgaggaggaccccaaggagcaggtcaaacgctatgggggctttttgcgcaaataccccaagaggagctcagaggtggctggggagggggacggggatagcatgggccatgaggacctgtacaaacgctatgggggcttcttgcggcgcattcgtcccaagctcaagtgggacaaccagaagcgctatggcggttttctccggcgccagttcaaggtggtgactcggtctcaggaagatccgaatgcttactctggagagctttttgatgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - homeobox A5
- homeobox A9
- syntaxin 19
- neuregulin 1