Login to display prices
Login to display prices
EDN1-endothelin 1 Gene View larger

EDN1-endothelin 1 Gene

PTXBC009720

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDN1-endothelin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EDN1-endothelin 1 Gene

Proteogenix catalog: PTXBC009720
Ncbi symbol: EDN1
Product name: EDN1-endothelin 1 Gene
Size: 2ug
Accessions: BC009720
Gene id: 1906
Gene description: endothelin 1
Synonyms: ARCND3; ET1; HDLCQ7; PPET1; QME; endothelin-1; preproendothelin-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattatttgctcatgattttctctctgctgtttgtggcttgccaaggagctccagaaacagcagtcttaggcgctgagctcagcgcggtgggtgagaacggcggggagaaacccactcccagtccaccctggcggctccgccggtccaagcgctgctcctgctcgtccctgatggataaagagtgtgtctacttctgccacctggacatcatttgggtcaacactcccgagcacgttgttccgtatggacttggaagccctaggtccaagagagccttggagaatttacttcccacaaaggcaacagaccgtgagaatagatgccaatgtgctagccaaaaagacaagaagtgctggaatttttgccaagcaggaaaagaactcagggctgaagacattatggagaaagactggaataatcataagaaaggaaaagactgttccaagcttgggaaaaagtgtatttatcagcagttagtgagaggaagaaaaatcagaagaagttcagaggaacacctaagacaaaccaggtcggagaccatgagaaacagcgtcaaatcatcttttcatgatcccaagctgaaaggcaatccctccagagagcgttatgtgacccacaaccgagcacattggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: