DPT-dermatopontin Gene View larger

DPT-dermatopontin Gene

PTXBC033736

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPT-dermatopontin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPT-dermatopontin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033736
Product type: DNA & cDNA
Ncbi symbol: DPT
Origin species: Human
Product name: DPT-dermatopontin Gene
Size: 2ug
Accessions: BC033736
Gene id: 1805
Gene description: dermatopontin
Synonyms: TRAMP; dermatopontin; tyrosine-rich acidic matrix protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctcagtcttctctgggtacttctgcccctagtcaccatggcctggggccagtatggcgattatggatacccataccagcagtatcatgactacagcgatgatgggtgggtgaatttgaaccggcaaggcttcagctaccagtgtccccaggggcaggtgatagtggccgtgaggagcatcttcagcaagaaggaaggttctgacagacaatggaactacgcctgcatgcccacaccacagagcctcggggaacccacggagtgctggtgggaggagatcaacagggctggcatggaatggtaccagacgtgctccaacaatgggctggtggcaggattccagagccgctacttcgagtcagtgctggatcgggagtggcagttttactgttgtcgctacagcaagaggtgcccatattcctgctggctaacaatagaatatccaggtcactatggtgaggaaatggacatgatttcctacaattatgattactatatccgaggagcaacaaccactttctctgcagtggaaagggatcgccagtggaagttcataatgtgccggatgactgaatacgactgtgaatttgcaaatgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 11
- endothelin 1
- KIAA0907
- homeobox B9

Buy DPT-dermatopontin Gene now

Add to cart