Login to display prices
Login to display prices
ATP5SL-ATP5S-like Gene View larger

ATP5SL-ATP5S-like Gene

PTXBC013323

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5SL-ATP5S-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5SL-ATP5S-like Gene

Proteogenix catalog: PTXBC013323
Ncbi symbol: ATP5SL
Product name: ATP5SL-ATP5S-like Gene
Size: 2ug
Accessions: BC013323
Gene id: 55101
Gene description: ATP5S-like
Synonyms: ATP synthase subunit s-like protein; ATP5S like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctccctgggcgtccctgcgcctggtcgcccccatgtggaatgggcgtatcaggggcatccatcgcctgggtgcggcagtggccccagagggcaatcagaagaagaaaaggacaatactccagttcctgaccaactatttctacgatgtggaggctctgagggattacttgctccaaagggagatgtacaaggtgcatgagaaaaatcggtttcgagacaaggagtggatcaggccagataagtatggccatttctctcaggagttctggaatttctgtgaagtgcctgtcgaagctgtggatgccggtgactgtgacatcaactacgagggcctggataacctccgaacctccgcaggctggacatctcggacctccctgccgtgtccaaccctggcctcactcagatattggtggaggagatgctgcccaattgcgaggttgtgggagtcgactgggctgagggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice