Login to display prices
Login to display prices
EDN2-endothelin 2 Gene View larger

EDN2-endothelin 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDN2-endothelin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EDN2-endothelin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034393
Product type: DNA & cDNA
Ncbi symbol: EDN2
Origin species: Human
Product name: EDN2-endothelin 2 Gene
Size: 2ug
Accessions: BC034393
Gene id: 1907
Gene description: endothelin 2
Synonyms: ET-2; ET2; PPET2; endothelin-2; preproendothelin 2; endothelin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtgcgtctacttctgccacttggacatcatctgggtgaacactcctgaacagacagctccttacggcctgggaaacccgccaagacgccggcgccgctccctgccaaggcgctgtcagtgctccagtgccagggaccccgcctgtgccaccttctgccttcgaaggccctggactgaagccggggcagtcccaagccggaagtcccctgcagacgtgttccagactggcaagacaggggccactacaggagagcttctccaaaggctgagggacatttccacagtcaagagcctctttgccaagcgacaacaggaggccatgcgggagcctcggtccacacattccaggtggaggaagagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SAP30-like
- glyoxalase I
- dermatopontin
- claudin 11