Login to display prices
Login to display prices
CPLX3-complexin 3 Gene View larger

CPLX3-complexin 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPLX3-complexin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CPLX3-complexin 3 Gene

Proteogenix catalog: PTXBC018026
Ncbi symbol: CPLX3
Product name: CPLX3-complexin 3 Gene
Size: 2ug
Accessions: BC018026
Gene id: 594855
Gene description: complexin 3
Synonyms: CPX-III; CPXIII; Nbla11589; complexin-3; CPX III; complexin III; complexin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttcatggtgaagaccatggtgggcggccagctgaagaacctcactgggagcctgggaggcggcgaggataagggagatggggacaagtcggcagccgaagctcagggcatgagccgggaggagtacgaggagtatcagaagcaactcgtggaagagaagatggagcgggatgcacagttcacacagaggaaggcagagcgggccacactgcggagccacttccgagacaaataccggctacccaagaacgagacagatgagagccagatccagatggcaggtggagacgtggagctgccccgggagctggccaagatgatcgaggaggacacagaggaggaggaggagaaggcctcagtccttgggcagctggccagccttcctggcttgaacctgggctcactcaaggacaaggcccaggccacactgggggatctcaagcaatcagctgagaagtgtcacgtcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice