ORMDL1-ORM1-like 1 (S. cerevisiae) Gene View larger

ORMDL1-ORM1-like 1 (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORMDL1-ORM1-like 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ORMDL1-ORM1-like 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005200
Product type: DNA & cDNA
Ncbi symbol: ORMDL1
Origin species: Human
Product name: ORMDL1-ORM1-like 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005200
Gene id: 94101
Gene description: ORM1-like 1 (S. cerevisiae)
Synonyms: ORM1-like protein 1; adoplin-1; ORMDL sphingolipid biosynthesis regulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgttggagttgcccacagtgaagtgaatccaaatacccgtgtcatgaacagccggggtatgtggctgacatatgcattgggagttggcttgcttcatattgtcttactcagcattcccttcttcagtgttcctgttgcttggactttaacaaatattatacataatctggggatgtacgtatttttgcatgcagtgaaaggaacacctttcgaaactcctgaccagggtaaagcaaggctcctaactcattgggaacaactggactatggagtacagtttacatcttcacggaagtttttcacaatttctccaataattctatattttctggcaagtttctatacgaagtatgatccaactcacttcatcctaaacacagcttctctcctgagtgtactaattcccaaaatgccacaactacatggtgttcggatctttggaattaataagtattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peripheral myelin protein 22
- serine/threonine kinase 32A
- RNA binding motif protein 8A
- ferritin, heavy polypeptide 1

Buy ORMDL1-ORM1-like 1 (S. cerevisiae) Gene now

Add to cart