Login to display prices
Login to display prices
PTGES-prostaglandin E synthase Gene View larger

PTGES-prostaglandin E synthase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTGES-prostaglandin E synthase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTGES-prostaglandin E synthase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008280
Product type: DNA & cDNA
Ncbi symbol: PTGES
Origin species: Human
Product name: PTGES-prostaglandin E synthase Gene
Size: 2ug
Accessions: BC008280
Gene id: 9536
Gene description: prostaglandin E synthase
Synonyms: MGST-IV; MGST1-L1; MGST1L1; MPGES; PGES; PIG12; PP102; PP1294; TP53I12; mPGES-1; MGST1-like 1; glutathione S-transferase 1-like 1; microsomal glutathione S-transferase 1-like 1; microsomal prostaglandin E synthase-1; p53-induced apoptosis protein 12; p53-induced gene 12 protein; tumor protein p53 inducible protein 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgcccacagcctggtgatgagcagcccggccctcccggccttcctgctctgcagcacgctgctggtcatcaagatgtacgtggtggccatcatcacgggccaagtgaggctgcggaagaaggcctttgccaaccccgaggatgccctgagacacggaggcccccagtattgcaggagcgaccccgacgtggaacgctgcctcagggcccaccggaacgacatggagaccatctaccccttccttttcctgggcttcgtctactcctttctgggtcctaacccttttgtcgcctggatgcacttcctggtcttcctcgtgggccgtgtggcacacaccgtggcctacctggggaagctgcgggcacccatccgctccgtgacctacaccctggcccagctcccctgcgcctccatggctctgcagatcctctgggaagcggcccgccacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 607
- troponin C type 2 (fast)
- BCL2-related protein A1
- ADP-ribosylation factor 4