Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PTGES-prostaglandin E synthase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTGES-prostaglandin E synthase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008280 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTGES |
| Origin species: | Human |
| Product name: | PTGES-prostaglandin E synthase Gene |
| Size: | 2ug |
| Accessions: | BC008280 |
| Gene id: | 9536 |
| Gene description: | prostaglandin E synthase |
| Synonyms: | MGST-IV; MGST1-L1; MGST1L1; MPGES; PGES; PIG12; PP102; PP1294; TP53I12; mPGES-1; MGST1-like 1; glutathione S-transferase 1-like 1; microsomal glutathione S-transferase 1-like 1; microsomal prostaglandin E synthase-1; p53-induced apoptosis protein 12; p53-induced gene 12 protein; tumor protein p53 inducible protein 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgcccacagcctggtgatgagcagcccggccctcccggccttcctgctctgcagcacgctgctggtcatcaagatgtacgtggtggccatcatcacgggccaagtgaggctgcggaagaaggcctttgccaaccccgaggatgccctgagacacggaggcccccagtattgcaggagcgaccccgacgtggaacgctgcctcagggcccaccggaacgacatggagaccatctaccccttccttttcctgggcttcgtctactcctttctgggtcctaacccttttgtcgcctggatgcacttcctggtcttcctcgtgggccgtgtggcacacaccgtggcctacctggggaagctgcgggcacccatccgctccgtgacctacaccctggcccagctcccctgcgcctccatggctctgcagatcctctgggaagcggcccgccacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 607 - troponin C type 2 (fast) - BCL2-related protein A1 - ADP-ribosylation factor 4 |