UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene View larger

UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005979
Product type: DNA & cDNA
Ncbi symbol: UBE2B
Origin species: Human
Product name: UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene
Size: 2ug
Accessions: BC005979
Gene id: 7320
Gene description: ubiquitin-conjugating enzyme E2B (RAD6 homolog)
Synonyms: E2-17kDa; HHR6B; HR6B; RAD6B; UBC2; ubiquitin-conjugating enzyme E2 B; E2 protein; E2 ubiquitin-conjugating enzyme B; RAD6 homolog B; ubiquitin carrier protein B; ubiquitin conjugating enzyme E2B; ubiquitin-conjugating enzyme E2-17 kDa; ubiquitin-conjugating enzyme E2B (RAD6 homolog); ubiquitin-protein ligase B; ubiquitin conjugating enzyme E2 B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaattttctgaagaatatccaaataaaccaccaactgttaggtttttatccaaaatgtttcatccaaatgtgtatgctgatggtagcatatgtttagatatccttcagaatcgatggagtccaacatatgatgtatcttctatcttaacatcaattcagtctctgctggatgaaccgaatcctaacagtccagccaatagccaggcagcacagctttatcaggaaaacaaacgagaatatgagaaaagagtttcggccattgttgaacaaagctggaatgattcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cutA divalent cation tolerance homolog (E. coli)
- vitamin K epoxide reductase complex, subunit 1
- family with sequence similarity 176, member B
- family with sequence similarity 156, member A

Buy UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene now

Add to cart