Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005979 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2B |
| Origin species: | Human |
| Product name: | UBE2B-ubiquitin-conjugating enzyme E2B (RAD6 homolog) Gene |
| Size: | 2ug |
| Accessions: | BC005979 |
| Gene id: | 7320 |
| Gene description: | ubiquitin-conjugating enzyme E2B (RAD6 homolog) |
| Synonyms: | E2-17kDa; HHR6B; HR6B; RAD6B; UBC2; ubiquitin-conjugating enzyme E2 B; E2 protein; E2 ubiquitin-conjugating enzyme B; RAD6 homolog B; ubiquitin carrier protein B; ubiquitin conjugating enzyme E2B; ubiquitin-conjugating enzyme E2-17 kDa; ubiquitin-conjugating enzyme E2B (RAD6 homolog); ubiquitin-protein ligase B; ubiquitin conjugating enzyme E2 B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaattttctgaagaatatccaaataaaccaccaactgttaggtttttatccaaaatgtttcatccaaatgtgtatgctgatggtagcatatgtttagatatccttcagaatcgatggagtccaacatatgatgtatcttctatcttaacatcaattcagtctctgctggatgaaccgaatcctaacagtccagccaatagccaggcagcacagctttatcaggaaaacaaacgagaatatgagaaaagagtttcggccattgttgaacaaagctggaatgattcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cutA divalent cation tolerance homolog (E. coli) - vitamin K epoxide reductase complex, subunit 1 - family with sequence similarity 176, member B - family with sequence similarity 156, member A |