Login to display prices
Login to display prices
DNAL1-dynein, axonemal, light chain 1 Gene View larger

DNAL1-dynein, axonemal, light chain 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAL1-dynein, axonemal, light chain 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAL1-dynein, axonemal, light chain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005343
Product type: DNA & cDNA
Ncbi symbol: DNAL1
Origin species: Human
Product name: DNAL1-dynein, axonemal, light chain 1 Gene
Size: 2ug
Accessions: BC005343
Gene id: 83544
Gene description: dynein, axonemal, light chain 1
Synonyms: C14orf168; CILD16; dynein light chain 1, axonemal; dynein axonemal light chain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcatccttgtccatgcttgctaattgcgagaagctttcactgtctacaaactgcattgaaaaaattgccaacctgaatggcttaaaaaacttgaggatattatctttaggaagaaacaacataaagaacttaaatggactggaggcagtaggggacacattagaagaactgtggatctcctacaattttattgagaagttgaaagggatccacataatgaagaaattgaagattctctacatgtctaataacctggtaaaagactgggctgagtttgtgaagctggcagaactgccatgcctcgaagacctggtgtttgtaggcaatcccttggaagagaaacattctgctgagaataactggattgaagaagcaaccaagagagtgcccaaactgaaaaagctggatggtactccagtaattaaaggggatgaggaagaagacaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aarF domain containing kinase 5
- XTP3-transactivated protein A
- ADP-ribosylation factor-like 8B
- ADP-ribosylation factor-like 14