Login to display prices
Login to display prices
PDE6D-phosphodiesterase 6D, cGMP-specific, rod, delta Gene View larger

PDE6D-phosphodiesterase 6D, cGMP-specific, rod, delta Gene

PTXBC007831

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDE6D-phosphodiesterase 6D, cGMP-specific, rod, delta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDE6D-phosphodiesterase 6D, cGMP-specific, rod, delta Gene

Proteogenix catalog: PTXBC007831
Ncbi symbol: PDE6D
Product name: PDE6D-phosphodiesterase 6D, cGMP-specific, rod, delta Gene
Size: 2ug
Accessions: BC007831
Gene id: 5147
Gene description: phosphodiesterase 6D, cGMP-specific, rod, delta
Synonyms: JBTS22; PDED; retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit delta; GMP-PDE delta; phosphodiesterase 6D, cGMP-specific, rod, delta; protein p17; phosphodiesterase 6D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagccaaggacgagcgggccagggagatcctgaggggcttcaaactaaattggatgaaccttcgggatgctgagacagggaagatactctggcaaggaacagaagacctgtctgtccctggtgtggagcatgaagcccgtgttcccaagaaaatcctcaagtgcaaggcagtgtctcgagaacttaatttttcttcgacagaacaaatggaaaaattccgcctggaacaaaaagtttacttcaaagggcaatgcctagaagaatggttcttcgagtttggctttgtgatccctaactccacaaatacctggcagtccttgatagaggcagcacccgagtcccagatgatgccagcaagcgtcttaactgggaacgttatcatagaaacaaagttttttgacgacgatcttcttgtaagcacatccagagtgagacttttctatgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice