Login to display prices
Login to display prices
CLEC2B-C-type lectin domain family 2, member B Gene View larger

CLEC2B-C-type lectin domain family 2, member B Gene

PTXBC005254

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC2B-C-type lectin domain family 2, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC2B-C-type lectin domain family 2, member B Gene

Proteogenix catalog: PTXBC005254
Ncbi symbol: CLEC2B
Product name: CLEC2B-C-type lectin domain family 2, member B Gene
Size: 2ug
Accessions: BC005254
Gene id: 9976
Gene description: C-type lectin domain family 2, member B
Synonyms: AICL; CLECSF2; HP10085; IFNRG1; C-type lectin domain family 2 member B; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced); C-type lectin superfamily member 2; IFN-alpha-2b-inducing-related protein 1; IFN-alpha2b-inducing related protein 1; activation-induced C-type lectin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaccaaacataaaaagtgttttataattgttggtgttttaataacaactaatattattactctgatagttaaactaactcgagattctcagagtttatgcccctatgattggattggtttccaaaacaaatgctattatttctctaaagaagaaggagattggaattcaagtaaatacaactgttccactcaacatgccgacctaactataattgacaacatagaagaaacgaattttcttaggcggtataaatgcagttctgatcactggattggactgaagatggcaaaaaatcgaacaggacaatgggtagatggagctacatttaccaaatcgtttggcatgagagggagtgaaggatgtgcctacctcagcgatgatggtgcagcaacagctagatgttacaccgaaagaaaatggatttgcaggaaaagaatacactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice