Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CLEC2B-C-type lectin domain family 2, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLEC2B-C-type lectin domain family 2, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005254 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLEC2B |
| Origin species: | Human |
| Product name: | CLEC2B-C-type lectin domain family 2, member B Gene |
| Size: | 2ug |
| Accessions: | BC005254 |
| Gene id: | 9976 |
| Gene description: | C-type lectin domain family 2, member B |
| Synonyms: | AICL; CLECSF2; HP10085; IFNRG1; C-type lectin domain family 2 member B; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced); C-type lectin superfamily member 2; IFN-alpha-2b-inducing-related protein 1; IFN-alpha2b-inducing related protein 1; activation-induced C-type lectin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgaccaaacataaaaagtgttttataattgttggtgttttaataacaactaatattattactctgatagttaaactaactcgagattctcagagtttatgcccctatgattggattggtttccaaaacaaatgctattatttctctaaagaagaaggagattggaattcaagtaaatacaactgttccactcaacatgccgacctaactataattgacaacatagaagaaacgaattttcttaggcggtataaatgcagttctgatcactggattggactgaagatggcaaaaaatcgaacaggacaatgggtagatggagctacatttaccaaatcgtttggcatgagagggagtgaaggatgtgcctacctcagcgatgatggtgcagcaacagctagatgttacaccgaaagaaaatggatttgcaggaaaagaatacactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 10 open reading frame 111 - similar to common salivary protein 1 - trafficking protein particle complex 3 - guanylate cyclase activator 1A (retina) |