UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene View larger

UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005980
Product type: DNA & cDNA
Ncbi symbol: UBE2D1
Origin species: Human
Product name: UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene
Size: 2ug
Accessions: BC005980
Gene id: 7321
Gene description: ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
Synonyms: E2(17)KB1; SFT; UBC4/5; UBCH5; UBCH5A; ubiquitin-conjugating enzyme E2 D1; (E3-independent) E2 ubiquitin-conjugating enzyme D1; E2 ubiquitin-conjugating enzyme D1; UBC4/5 homolog; stimulator of Fe transport; ubiquitin carrier protein D1; ubiquitin conjugating enzyme E2D 1; ubiquitin-conjugating enzyme E2(17)KB 1; ubiquitin-conjugating enzyme E2-17 kDa 1; ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast); ubiquitin-protein ligase D1; ubiquitin conjugating enzyme E2 D1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgaagaggattcagaaagaattgagtgatctacagcgcgatccacctgctcactgttcagctggacctgtgggagatgacttgttccactggcaagccactattatggggcctcctgatagcgcatatcaaggtggagtcttctttctcactgtacattttccgacagattatccttttaaaccaccaaagattgctttcacaacaaaaatttaccatccaaacataaacagtaatggaagtatttgtctcgatattctgaggtcacaatggtcaccagctctgactgtatcaaaagttttattgtccatatgttctctactttgtgatcctaatccagatgaccccttagtaccagatattgcacaaatctataaatcagacaaagaaaaatacaacagacatgcaagagaatggactcagaaatatgcaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 3
- nudix (nucleoside diphosphate linked moiety X)-type motif 4
- CASP2 and RIPK1 domain containing adaptor with death domain
- oligonucleotide/oligosaccharide-binding fold containing 2A

Buy UBE2D1-ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) Gene now

Add to cart