Login to display prices
Login to display prices
TTR-transthyretin Gene View larger

TTR-transthyretin Gene

PTXBC005310

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTR-transthyretin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTR-transthyretin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005310
Product type: DNA & cDNA
Ncbi symbol: TTR
Origin species: Human
Product name: TTR-transthyretin Gene
Size: 2ug
Accessions: BC005310
Gene id: 7276
Gene description: transthyretin
Synonyms: CTS; CTS1; HEL111; HsT2651; PALB; TBPA; ATTR; carpal tunnel syndrome 1; epididymis luminal protein 111; prealbumin, amyloidosis type I; thyroxine-binding prealbumin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttctcatcgtctgctcctcctctgccttgctggactggtatttgtgtctgaggctggccctacgggcaccggtgaatccaagtgtcctctgatggtcaaagttctagatgctgtccgaggcagtcctgccatcaatgtggccgtgcatgtgttcagaaaggctgctgatgacacctgggagccatttgcctctgggaaaaccagtgagtctggagagctgcatgggctcacaactgaggaggaatttgtagaagggatatacaaagtggaaatagacaccaaatcttactggaaggcacttggcatctccccattccatgagcatgcagaggtggtattcacagccaacgactccggcccccgccgctacaccattgccgccctgctgagcccctactcctattccaccacggctgtcgtcaccaatcccaaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA1143
- complexin 3
- ATP5S-like
- endothelin 2