Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MED21-mediator complex subunit 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MED21-mediator complex subunit 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008380 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED21 |
| Origin species: | Human |
| Product name: | MED21-mediator complex subunit 21 Gene |
| Size: | 2ug |
| Accessions: | BC008380 |
| Gene id: | 9412 |
| Gene description: | mediator complex subunit 21 |
| Synonyms: | SRB7; SURB7; hSrb7; mediator of RNA polymerase II transcription subunit 21; RNA polymerase II holoenzyme component SRB7; RNAPII complex component SRB7; SRB7 suppressor of RNA polymerase B homolog; mediator complex subunit 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatcggctcacgcagcttcaggacgctgtgaattcgcttgcagatcagttttgtaatgccattggagtattgcagcaatgtggtcctcctgcctctttcaataatattcagacagcaattaacaaagaccagccagctaaccctacagaagagtatgcccagctttttgcagcactgattgcacgaacagcaaaagacattgatgttttgatagattccttacccagtgaagaatctacagctgctttacaggctgctagcttgtataagctagaagaagaaaaccatgaagctgctacatgtctggaggatgttgtttatcgaggagacatgcttctggagaagatacaaagcgcacttgctgatattgcacagtcacagctgaagacaagaagtggtacccatagccagtctcttccagactcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - M-phase phosphoprotein 6 - thymocyte nuclear protein 1 - vasoactive intestinal peptide - tryptophan rich basic protein |