Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HSPB11-heat shock protein family B (small), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPB11-heat shock protein family B (small), member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005245 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPB11 |
| Origin species: | Human |
| Product name: | HSPB11-heat shock protein family B (small), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC005245 |
| Gene id: | 51668 |
| Gene description: | heat shock protein family B (small), member 11 |
| Synonyms: | C1orf41; HSPCO34; IFT25; intraflagellar transport protein 25 homolog; heat shock protein beta-11; heat shock protein family B (small), member 11; intraflagellar transport 25 homolog; placental protein 25; heat shock protein family B (small) member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaaaaattgatctctgtctgagctctgaagggtccgaagtgattttagctacatcaagtgatgaaaaacacccacctgaaaatatcattgatgggaatccagaaacgttttggaccaccacaggaatgtttccccaggaattcattatttgtttccacaaacatgtaaggattgaaaggcttgtaatccaaagttactttgtacagaccttgaagattgaaaaaagcacgtctaaagagccagttgattttgagcaatggattgaaaaagatttggtacacacagaggggcagcttcaaaatgaagaaattgtggcacatgatggctccgctacttacttgagattcattattgtatcagcctttgatcattttgcatctgtgcatagcgtttctgcagaaggaacagtagtctcaaatctttcctcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 6D, cGMP-specific, rod, delta - ubiquitin-conjugating enzyme E2B (RAD6 homolog) - cutA divalent cation tolerance homolog (E. coli) - vitamin K epoxide reductase complex, subunit 1 |