Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TOMM22-translocase of outer mitochondrial membrane 22 homolog (yeast) Gene
PTXBC009363
New product
Data sheet of TOMM22-translocase of outer mitochondrial membrane 22 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOMM22-translocase of outer mitochondrial membrane 22 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009363 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM22 |
| Origin species: | Human |
| Product name: | TOMM22-translocase of outer mitochondrial membrane 22 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC009363 |
| Gene id: | 56993 |
| Gene description: | translocase of outer mitochondrial membrane 22 homolog (yeast) |
| Synonyms: | 1C9-2; MST065; MSTP065; TOM22; mitochondrial import receptor subunit TOM22 homolog; mitochondrial import receptor Tom22; translocase of outer membrane 22 kDa subunit homolog; translocase of outer mitochondrial membrane 22 homolog; translocase of outer mitochondrial membrane 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccgccgtcgctgctgccggtgcaggggaaccccagtccccggacgaattgctcccgaaaggcgacgcggagaagcctgaggaggagctggaggaggacgacgatgaggagctagatgagaccctgtcggagagactatggggcctgacggagatgtttccggagagggtccggtccgcggccggagccacttttgatctttccctctttgtggctcagaaaatgtacaggttttccagggcagccttgtggattgggaccacttcctttatgatcctggttcttcccgttgtctttgagacggagaagttgcaaatggagcaacagcagcaactgcagcagcggcagatacttctaggacctaacacagggctctcaggaggaatgccaggggctctaccctcacttcctggaaagatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) - SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) - inosine triphosphatase (nucleoside triphosphate pyrophosphatase) - required for meiotic nuclear division 1 homolog (S. cerevisiae) |