Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ITGB3BP-integrin beta 3 binding protein (beta3-endonexin) Gene
PTXBC014385
New product
Data sheet of ITGB3BP-integrin beta 3 binding protein (beta3-endonexin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ITGB3BP-integrin beta 3 binding protein (beta3-endonexin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014385 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ITGB3BP |
| Origin species: | Human |
| Product name: | ITGB3BP-integrin beta 3 binding protein (beta3-endonexin) Gene |
| Size: | 2ug |
| Accessions: | BC014385 |
| Gene id: | 23421 |
| Gene description: | integrin beta 3 binding protein (beta3-endonexin) |
| Synonyms: | CENP-R; CENPR; HSU37139; NRIF3; TAP20; centromere protein R; beta 3 endonexin; beta3-endonexin; integrin beta 3 binding protein (beta3-endonexin); integrin beta-3-binding protein; nuclear receptor-interacting factor 3; integrin subunit beta 3 binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtctatttgcttctcccacaagttctgaagagcaaaagcacagaaatggactatcaaatgaaaagagaaaaaaattgaatcaccccagtttaactgaaagcaaagaatctacaacaaaagacaatgatgaattcatgatgttgctatcaaaagttgagaaattgtcagaagaaatcatggagataatgcaaaatttaagtagtatacaggctttggagggcagtagagagcttgaaaatctcattggaatctcctgtgcatcacatttcttaaaaagagaaatgcagaaaaccaaagaactaatgacaaaagtgaataaacaaaaactgtttgaaaagagtacaggacttcctcacaaagcatcacgtcatcttgacagctatgaattccttaaagccattttaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog - cell division cycle 42 (GTP binding protein, 25kDa) - loss of heterozygosity, 12, chromosomal region 1 - hepatoma-derived growth factor, related protein 3 |