Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EEF1DP3-eukaryotic translation elongation factor 1 delta pseudogene 3 Gene
PTXBC021729
New product
Data sheet of EEF1DP3-eukaryotic translation elongation factor 1 delta pseudogene 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EEF1DP3-eukaryotic translation elongation factor 1 delta pseudogene 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021729 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EEF1DP3 |
| Origin species: | Human |
| Product name: | EEF1DP3-eukaryotic translation elongation factor 1 delta pseudogene 3 Gene |
| Size: | 2ug |
| Accessions: | BC021729 |
| Gene id: | 196549 |
| Gene description: | eukaryotic translation elongation factor 1 delta pseudogene 3 |
| Synonyms: | EF1G; GIG35; elongation factor 1-gamma; EF-1-gamma; PRO1608; eEF-1B gamma; pancreatic tumor-related protein; translation elongation factor eEF-1 gamma chain; eukaryotic translation elongation factor 1 gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctacaaactttctagtaggtgagaagatctggttccacaagttcaaatatggcgatgcagaaaggagattctacgaacagatgaacgggcctgtggccggcgcctccctccaggaggccagcatgatcctccatgatattgccagagccagagagaacatcccgaaatccctggccggaagcttaggcccaggggcgtctagcggccccagcggagaccacagcgagctcgtcgtccggatcgccagtctggaagtggacaaccagagagacctggctgaacgtgctggagaagagcttgcccggccactgggccacagccccgcagacccagcacatgtctcccatgcgccaagtggagcccccggccaagaagctagccacaccagcagaggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of outer mitochondrial membrane 22 homolog (yeast) - v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) - SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) - inosine triphosphatase (nucleoside triphosphate pyrophosphatase) |