Login to display prices
Login to display prices
EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene View larger

EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene

PTXBC005057

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene

Proteogenix catalog: PTXBC005057
Ncbi symbol: EIF4EBP2
Product name: EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene
Size: 2ug
Accessions: BC005057
Gene id: 1979
Gene description: eukaryotic translation initiation factor 4E binding protein 2
Synonyms: 4EBP2; PHASII; eukaryotic translation initiation factor 4E-binding protein 2; 4E-BP2; eIF4E-binding protein 2; phosphorylated, heat and acid stable regulated by insulin protein II; eukaryotic translation initiation factor 4E binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctcgtcagccggcagcggccaccagcccagccagagccgcgccatccccacccgcaccgtggccatcagcgacgccgcgcagctacctcatgactattgcaccacgcccggggggacgctcttctccaccacaccgggaggaactcgaatcatttatgacagaaagtttctgttggatcgtcgcaattctcccatggctcagaccccaccctgccacctgcccaatatcccaggagtcactagccctggcaccttaattgaagactccaaagtagaagtaaacaatttgaacaacttgaacaatcacgacaggaaacatgcagttggggatgatgctcagttcgagatggacatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: