PTXBC005057
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005057 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4EBP2 |
| Origin species: | Human |
| Product name: | EIF4EBP2-eukaryotic translation initiation factor 4E binding protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC005057 |
| Gene id: | 1979 |
| Gene description: | eukaryotic translation initiation factor 4E binding protein 2 |
| Synonyms: | 4EBP2; PHASII; eukaryotic translation initiation factor 4E-binding protein 2; 4E-BP2; eIF4E-binding protein 2; phosphorylated, heat and acid stable regulated by insulin protein II; eukaryotic translation initiation factor 4E binding protein 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctcgtcagccggcagcggccaccagcccagccagagccgcgccatccccacccgcaccgtggccatcagcgacgccgcgcagctacctcatgactattgcaccacgcccggggggacgctcttctccaccacaccgggaggaactcgaatcatttatgacagaaagtttctgttggatcgtcgcaattctcccatggctcagaccccaccctgccacctgcccaatatcccaggagtcactagccctggcaccttaattgaagactccaaagtagaagtaaacaatttgaacaacttgaacaatcacgacaggaaacatgcagttggggatgatgctcagttcgagatggacatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - spermatogenesis and oogenesis specific basic helix-loop-helix 2 - UTP23, small subunit (SSU) processome component, homolog (yeast) - proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) |