PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene View larger

PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000352
Product type: DNA & cDNA
Ncbi symbol: PSME1
Origin species: Human
Product name: PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene
Size: 2ug
Accessions: BC000352
Gene id: 5720
Gene description: proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
Synonyms: HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha; proteasome activator complex subunit 1; 11S regulator complex subunit alpha; 29-kD MCP activator subunit; IGUP I-5111; activator of multicatalytic protease subunit 1; epididymis secretory sperm binding protein Li 129m; interferon gamma up-regulated I-5111 protein; interferon-gamma IEF SSP 5111; interferon-gamma-inducible protein 5111; proteasome (prosome, macropain) activator subunit 1 (PA28 alpha); proteasome activator subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcatttttaaaggagccagctctcaatgaagccaacttgagcaatctgaaggccccattggacatcccagtgcctgatccagtcaaggagaaagagaaagaggagcggaagaaacagcaggagaaggaagacaaggatgaaaagaagaagggggaggatgaagacaaaggtcctccctgtggcccagtgaactgcaatgaaaagatcgtggtccttctgcagcgcttgaagcctgagatcaaggatgtcattgagcagctcaacctggtcaccacctggttgcagctgcagatacctcggattgaggatggtaacaattttggagtggctgtccaggagaaggtgtttgagctgatgaccagcctccacaccaagctagaaggcttccacactcaaatctctaagtatttctctgagcgtggtgatgcagtgactaaagcagccaagcagccccatgtgggtgattatcggcagctggtgcacgagctggatgaggcagagtaccgggacatccggctgatggtcatggagatccgcaatgcttatgctgtgttatatgacatcatcctgaagaacttcgagaagctcaagaagcccaggggagaaacaaagggaatgatctattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
- dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
- cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)
- defective in sister chromatid cohesion 1 homolog (S. cerevisiae)

Buy PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene now

Add to cart