Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene
PTXBC000352
New product
Data sheet of PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSME1 |
| Origin species: | Human |
| Product name: | PSME1-proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Gene |
| Size: | 2ug |
| Accessions: | BC000352 |
| Gene id: | 5720 |
| Gene description: | proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) |
| Synonyms: | HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha; proteasome activator complex subunit 1; 11S regulator complex subunit alpha; 29-kD MCP activator subunit; IGUP I-5111; activator of multicatalytic protease subunit 1; epididymis secretory sperm binding protein Li 129m; interferon gamma up-regulated I-5111 protein; interferon-gamma IEF SSP 5111; interferon-gamma-inducible protein 5111; proteasome (prosome, macropain) activator subunit 1 (PA28 alpha); proteasome activator subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcatttttaaaggagccagctctcaatgaagccaacttgagcaatctgaaggccccattggacatcccagtgcctgatccagtcaaggagaaagagaaagaggagcggaagaaacagcaggagaaggaagacaaggatgaaaagaagaagggggaggatgaagacaaaggtcctccctgtggcccagtgaactgcaatgaaaagatcgtggtccttctgcagcgcttgaagcctgagatcaaggatgtcattgagcagctcaacctggtcaccacctggttgcagctgcagatacctcggattgaggatggtaacaattttggagtggctgtccaggagaaggtgtttgagctgatgaccagcctccacaccaagctagaaggcttccacactcaaatctctaagtatttctctgagcgtggtgatgcagtgactaaagcagccaagcagccccatgtgggtgattatcggcagctggtgcacgagctggatgaggcagagtaccgggacatccggctgatggtcatggagatccgcaatgcttatgctgtgttatatgacatcatcctgaagaacttcgagaagctcaagaagcccaggggagaaacaaagggaatgatctattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) - dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) - cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) - defective in sister chromatid cohesion 1 homolog (S. cerevisiae) |