Login to display prices
Login to display prices
DSCC1-defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene View larger

DSCC1-defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene

PTXBC001531

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DSCC1-defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DSCC1-defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001531
Product type: DNA & cDNA
Ncbi symbol: DSCC1
Origin species: Human
Product name: DSCC1-defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001531
Gene id: 79075
Gene description: defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
Synonyms: DCC1; sister chromatid cohesion protein DCC1; defective in sister chromatid cohesion 1 homolog; defective in sister chromatid cohesion protein 1 homolog; DNA replication and sister chromatid cohesion 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaggacccgcgacgaggtggatgcgacgctgcagatcgccaagctgaatgcggccgagctgctgccggcggtgcactgcctgggcttcggccctggggccagcggcgctgcagccggcgacttctgcctgctggagctggagcccacgctgtgccagcagctggaggatggacacagtcttgtgattcgtggtgataaagacgagcaagctgtgctgtgcagtaaagacaaaacatacgacttgaagatagcagacacttccaatatgttgcttttcattcctggttgtaaaactccggaccagttgaagaaggaagattcacactgtaacattattcacactgagatctttggtttttctaataattattgggaattaagaagacgtagacccaagttaaagaagctaaagaaacttttgatggaaaatccatatgaaggacctgacagtcaaaaagagaaggattcaaatagctcaaaatatacaactgaagatttgcttgatcaaattcaggcaagtgaggaagaaataatgacccaattacaagttctaaatgcctgtaagattggaggttattggaggattcttgaatttgattatgagatgaaacttctgaatcatgtaactcagcttgtggattctgaatcatggtcttttggtaaagttcctttgaacacatgccttcaggaactcggaccattggagccagaggaaatgatagaacactgtcttaaatgttatgggaagaaatatgtagatgaaggcgaagtttattttgagttggatgctgataaaatatgtagagcagcagcacgaatgctacttcagaatgcggtgaaattcaatctcgctgagtttcaagaagtgtggcagcagagtgttcctgaaggaatggtaactagtcttgatcagcttaagggtttagcgctggtggatagacactcgagaccagaaatcatatttttgctgaaagtagatgatttacctgaggataatcaggaacgttttaatagccttttctctctaagggagaagtggacagaagaagatattgctccatatattcaagatttgtgtggagagaagcaaaccataggtgcattactcactaaatattctcattcttcgatgcaaaatggtgttaaagtttataattcgagaagacccatttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
- solute carrier family 22 (organic anion transporter), member 6
- BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
- RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)