DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene View larger

DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene

PTXBC031244

New product

Data sheet of DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC031244
Product type: DNA & cDNA
Ncbi symbol: DYRK4
Origin species: Human
Product name: DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene
Size: 2ug
Accessions: BC031244
Gene id: 8798
Gene description: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Synonyms: dual specificity tyrosine-phosphorylation-regulated kinase 4; dual specificity tyrosine-(Y)-phosphorylation regulated kinase 4; dual specificity tyrosine phosphorylation regulated kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggcctcagagctcaaggcttcagaaatacctttccaccctagcattaaaacccaggatcccaaggcagaggagaagtcaccaaagaagcaaaaggtgactctgacagcggcagaggccctaaagctttttaagaaccagctgtctccatatgaacaaagtgaaatcctgggctacgcggagctgtggttcctgggtcttgaagccaagaagctcgacacggctcctgagaaatttagcaagacgagttttgatgatgagcatggcttctatctgaaggttctgcatgatcacattgcctaccgctatgaagttctggagacaatcgggaaggggtcctttggacaggtggccaagtgcttggatcacaaaaacaatgagctggtggccctgaaaatcatcaggaacaagaagaggtttcaccagcaggccctgatggagctgaagatcctggaagctctcagaaagaaggacaaagacaacacctacaatgtggtgcatatgaaggactttttctactttcgcaatcacttctgcatcacctttgagctcctgggaatcaacttgtatgagttgatgaagaataacaactttcaaggcttcagtctgtccatagttcggcgcttcactctctctgttttgaagtgcttgcagatgctttcggtagagaaaatcattcactgtgatctcaagcccgaaaatatagtgctataccaaaagggccaagcctctgttaaagtcattgactttggatcaagctgttatgaacaccagaaagtatacacgtacatccaaagccggttctaccgatccccagaagtgatcctgggccacccctacgacgtggccattgacatgtggagcctgggctgcatcacggcggagttgtacacgggctaccccctgttccccggggagaatgaggtggagcagctggcctgcatcatggaggtgctgggtctgccgccagccggcttcattcagacagcctccaggagacagacattctttgattccaaaggttttcctaaaaatataaccaacaacagggggaaaaaaagatacccagattccaaggacctcacgatggtgctgaaaacctatgacaccagcttcctggactttctcagaaggtgtttggtatgggaaccttctcttcgcatgaccccggaccaggccctcaagcatgcttggattcatcagtctcggaacctcaagccacagcccaggccccagaccctgaggaaatccaattcctttttcccctctgagacaaggaaggacaaggttcaaggctgtcatcactcgagcagaaaagcagatgagatcaccaaagagactacagagaaaacaaaagatagccccacgaagcatgttcagcattcaggtgatcagcaggactgtctccagcacggagctgacactgttcagctgcctcaactggtagacgctcccaagaagtcagaggcagctgtcggggcggaggtgtccatgacctccccaggacagagcaaaaacttctccctcaagaacacaaacgttttaccccctattgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 22 (organic anion transporter), member 6
- BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
- RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
- dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

Buy DYRK4-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 Gene now

Add to cart