Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RER1-RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Gene
PTXBC004965
New product
Data sheet of RER1-RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RER1-RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004965 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RER1 |
| Origin species: | Human |
| Product name: | RER1-RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC004965 |
| Gene id: | 11079 |
| Gene description: | RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) |
| Synonyms: | RER1 retention in endoplasmic reticulum 1 homolog; protein RER1; retention in endoplasmic reticulum sorting receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgaaggggacagtgtgggagaatccgtccatgggaaaccttcggtggtgtacagatttttcacaagacttggacagatttatcagtcctggctagacaagtccacaccctacacggctgtgcgatgggtcgtgacactgggcctgagctttgtctacatgattcgagtttacctgctgcagggttggtacattgtgacctatgccttggggatctaccatctaaatcttttcatagcttttctttctcccaaagtggatccttccttaatggaagactcagatgacggtccttcgctacccaccaaacagaacgaggaattccgccccttcattcgaaggctcccagagtttaaattttggcatgcggctaccaagggcatccttgtggctatggtctgtactttcttcgacgctttcaacgtcccggtgttctggccgattctggtgatgtacttcatcatgctcttctgtatcacgatgaagaggcaaatcaagcacatgattaagtaccggtacatcccgttcacacatgggaagagaaggtacagaggcaaggaggatgccggcaaggccttcgccagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 - matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) - CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 - phosphodiesterase 4C, cAMP-specific (phosphodiesterase E1 dunce homolog, Drosophila) |