Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CTDSP2-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Gene
PTXBC065920
New product
Data sheet of CTDSP2-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTDSP2-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065920 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTDSP2 |
| Origin species: | Human |
| Product name: | CTDSP2-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Gene |
| Size: | 2ug |
| Accessions: | BC065920 |
| Gene id: | 10106 |
| Gene description: | CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 |
| Synonyms: | OS4; PSR2; SCP2; carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 2; CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2; NLI-interacting factor 2; conserved gene amplified in osteosarcoma; nuclear LIM interactor-interacting factor 2; protein OS-4; small C-terminal domain phosphatase 2; small CTD phosphatase 2; CTD small phosphatase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacacggctccatcatcacccaggcgcggagggaagacgccctggtgctcaccaagcaaggcctggtctccaagtcctctcctaagaagcctcgtggacgtaacatcttcaaggcccttttctgctgttttcgcgcccagcatgttggccagtcaagttcctccactgagctcgctgcgtataaggaggaagcaaacaccattgctaagtcggatctgctccagtgtctccagtaccagttctaccagatcccagggacctgcctgctcccagaggtgacagaggaagatcaaggaaggatctgtgtggtcattgacctcgatgaaacccttgtgcatagctcctttaagccaatcaacaatgctgacttcatagtgcctatagagattgaggggaccactcaccaggtgtatgtgctcaagaggccttatgtggatgagttcctgagacgcatgggggaactctttgaatgtgttctcttcactgccagcctggccaagtatgccgaccctgtgacagacctgctggaccggtgtggggtgttccgggcccgcctattccgtgagtcttgcgtgttccaccagggctgctacgtcaaggacctcagccgcctggggagggacctgagaaagaccctcatcctggacaactcgcctgcttcttacatattccaccccgagaatgcagtgcctgtgcagtcctggtttgatgacatggcagacactgagttgctgaacctgatcccaatctttgaggagctgagcggagcagaggacgtctacaccagccttgggcagctgcgggccccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 4C, cAMP-specific (phosphodiesterase E1 dunce homolog, Drosophila) - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta - killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 - amyloid beta (A4) precursor protein-binding, family B, member 2 |