Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR3DS1-killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 Gene
PTXBC098288
New product
Data sheet of KIR3DS1-killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR3DS1-killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098288 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR3DS1 |
| Origin species: | Human |
| Product name: | KIR3DS1-killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 Gene |
| Size: | 2ug |
| Accessions: | BC098288 |
| Gene id: | 3813 |
| Gene description: | killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 |
| Synonyms: | killer cell immunoglobulin-like receptor KIR3DS1; CD158E2; KIR-123FM; KIR-G1; NKAT-10; NKAT10; killer cell immunoglobulin-like receptor 3DS1; killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1; natural killer-associated transcript 10; killer cell immunoglobulin like receptor, three Ig domains and short cytoplasmic tail 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgctcatggtcgtcagcatggcgtgtgttgggttgttcttggtccagagggccggtccacacatgggtggtcaggacaagcccttcctgtctgcctggcccagcgctgtggtgcctcgcggaggacacgtgactcttcggtgtcactatcgtcataggtttaacaatttcatgctatacaaagaagacagaatccacgttcccatcttccatggcagaatattccaggagggcttcaacatgagccctgtgaccacagcacatgcagggaactacacatgtcggggttcacacccacactcccccactgggtggtcggcacccagcaaccccatggtgatcatggtcacaggaaaccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcaggagagagagtcatcctgcaatgttggtcagatatcatgtttgagcacttctttctgcacaaagagtggatctctaaggacccctcacgcctcgttggacagatccatgatggggtctccaaggccaatttctccatcggttccatgatgcgtgcccttgcagggacctacagatgctacggttctgttactcacaccccctatcagttgtcagctcccagtgatcccctggacatcgtggtcacaggtctatatgagaaaccttctctctcagcccagccgggccccaaggttcaggcaggagagagcgtgaccttgtcctgtagctcccggagctcctatgacatgtaccatctatccagggaggggggagcccatgaacgtaggctccctgcagtgcgcaaggtcaacagaacattccaggcagatttccctctgggccctgccacccacggagggacctacagatgcttcggctctttccgtcactctccctacgagtggtcagacccgagtgacccactgcttgtttctgtcacaggaaacccttcaagtagttggccttcacccacagaaccaagctccaaatctggtaacctcagacacctgcacattctgattgggacctcagtggtcaaaatccctttcaccatcctcctcttctttctccttcatcgctggtgctccaacaaaaaaaaatgctgctgtaatggaccaagagcctgcagggaacagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amyloid beta (A4) precursor protein-binding, family B, member 2 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa - heat shock protein 90kDa alpha (cytosolic), class B member 1 - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) |