Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene
PTXBC027946
New product
Data sheet of APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027946 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APBB2 |
| Origin species: | Human |
| Product name: | APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC027946 |
| Gene id: | 323 |
| Gene description: | amyloid beta (A4) precursor protein-binding, family B, member 2 |
| Synonyms: | FE65L; FE65L1; amyloid beta A4 precursor protein-binding family B member 2; Fe65-like 1; protein Fe65-like 1; amyloid beta precursor protein binding family B member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaagaggacctcgcccccggtaaaagtagtgttgcggtcaacaactgcatcaggcaactttcctactgcaaaaatgacatccgagacacagtcgggatttggggagaggggaaagacatgtacctgatcctggagaatgacatgctcagcctggtggaccccatggaccgcagcgtgctgcactcgcagcccatcgtcagcatccgcgtgtggggcgtgggccgcgacaatggccgggattttgcttatgtagcaagagataaagatacaagaattttgaaatgtcatgtatttcgatgtgacacaccagcaaaagccattgccacaagtctccacgagatctgctccaagattatggctgaacggaagaatgccaaagcgctggcctgcagctccttacaggaaagggccaatgtgaacctcgatgtccctttgcaagattttccaacaccaaagactgagctggtccagaagttccacgtgcagtacttgggcatgttacctgtagacaaaccagtcggaatggatattttgaacagtgccatagaaaatcttatgacctcatccaacaaggaggactggctgtcagtgaacatgaacgtggctgatgccactgtgactgtcatcagtgaaaagaatgaagaggaagtcttagtggaatgtcgtgtgcgattcctgtccttcatgggtgttgggaaggacgtccacacatttgccttcatcatggacacggggaaccagcgctttgagtgccacgttttctggtgcgagcctaatgctggtaacgtgtctgaggcggtgcaggccgcctgcatgttacgatatcagaagtgcttggtagccaggccgccttctcagaaagttcgaccacctccaccgccagcagattcagtaaccagaagagtcacaaccaatgtaaaacgaggggtcttatccctcattgacactttgaaacagaaacgccctgtcaccgaaatgccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa - heat shock protein 90kDa alpha (cytosolic), class B member 1 - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa |