APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene View larger

APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene

PTXBC027946

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027946
Product type: DNA & cDNA
Ncbi symbol: APBB2
Origin species: Human
Product name: APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene
Size: 2ug
Accessions: BC027946
Gene id: 323
Gene description: amyloid beta (A4) precursor protein-binding, family B, member 2
Synonyms: FE65L; FE65L1; amyloid beta A4 precursor protein-binding family B member 2; Fe65-like 1; protein Fe65-like 1; amyloid beta precursor protein binding family B member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaagaggacctcgcccccggtaaaagtagtgttgcggtcaacaactgcatcaggcaactttcctactgcaaaaatgacatccgagacacagtcgggatttggggagaggggaaagacatgtacctgatcctggagaatgacatgctcagcctggtggaccccatggaccgcagcgtgctgcactcgcagcccatcgtcagcatccgcgtgtggggcgtgggccgcgacaatggccgggattttgcttatgtagcaagagataaagatacaagaattttgaaatgtcatgtatttcgatgtgacacaccagcaaaagccattgccacaagtctccacgagatctgctccaagattatggctgaacggaagaatgccaaagcgctggcctgcagctccttacaggaaagggccaatgtgaacctcgatgtccctttgcaagattttccaacaccaaagactgagctggtccagaagttccacgtgcagtacttgggcatgttacctgtagacaaaccagtcggaatggatattttgaacagtgccatagaaaatcttatgacctcatccaacaaggaggactggctgtcagtgaacatgaacgtggctgatgccactgtgactgtcatcagtgaaaagaatgaagaggaagtcttagtggaatgtcgtgtgcgattcctgtccttcatgggtgttgggaaggacgtccacacatttgccttcatcatggacacggggaaccagcgctttgagtgccacgttttctggtgcgagcctaatgctggtaacgtgtctgaggcggtgcaggccgcctgcatgttacgatatcagaagtgcttggtagccaggccgccttctcagaaagttcgaccacctccaccgccagcagattcagtaaccagaagagtcacaaccaatgtaaaacgaggggtcttatccctcattgacactttgaaacagaaacgccctgtcaccgaaatgccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
- heat shock protein 90kDa alpha (cytosolic), class B member 1
- transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa

Buy APBB2-amyloid beta (A4) precursor protein-binding, family B, member 2 Gene now

Add to cart