Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene
PTXBC003102
New product
Data sheet of NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003102 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA7 |
| Origin species: | Human |
| Product name: | NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC003102 |
| Gene id: | 4701 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa |
| Synonyms: | B14.5a; CI-B14.5a; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa; NADH-ubiquinone oxidoreductase subunit B14.5a; complex I B14.5a subunit; NADH:ubiquinone oxidoreductase subunit A7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtccgccacccgtctcatccagcggctgcggaactgggcgtccgggcatgacctgcaggggaagctgcagctacgctaccaggagatctccaagcgaactcagcctcctcccaagctccctgtgggtcctagccacaagctctccaacaattactattgcactcgcgatggccgccgggaatctgtgcccccttccatcatcatgtcgtcgcagaaggcgctggtgtcaggcaagccagcagagagctctgctgtagctgccactgagaagaaggcggtgactccagctcctcccataaagaggtgggagctgtcctcggaccagccttacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 22 homolog (yeast) - polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like - transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) - heat shock protein 90kDa alpha (cytosolic), class B member 1 |