NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene View larger

NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003102
Product type: DNA & cDNA
Ncbi symbol: NDUFA7
Origin species: Human
Product name: NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene
Size: 2ug
Accessions: BC003102
Gene id: 4701
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Synonyms: B14.5a; CI-B14.5a; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa; NADH-ubiquinone oxidoreductase subunit B14.5a; complex I B14.5a subunit; NADH:ubiquinone oxidoreductase subunit A7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccgccacccgtctcatccagcggctgcggaactgggcgtccgggcatgacctgcaggggaagctgcagctacgctaccaggagatctccaagcgaactcagcctcctcccaagctccctgtgggtcctagccacaagctctccaacaattactattgcactcgcgatggccgccgggaatctgtgcccccttccatcatcatgtcgtcgcagaaggcgctggtgtcaggcaagccagcagagagctctgctgtagctgccactgagaagaaggcggtgactccagctcctcccataaagaggtgggagctgtcctcggaccagccttacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of inner mitochondrial membrane 22 homolog (yeast)
- polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like
- transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
- heat shock protein 90kDa alpha (cytosolic), class B member 1

Buy NDUFA7-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa Gene now

Add to cart