PTXBC002324
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC002324 |
Product type: | DNA & cDNA |
Ncbi symbol: | TIMM22 |
Origin species: | Human |
Product name: | TIMM22-translocase of inner mitochondrial membrane 22 homolog (yeast) Gene |
Size: | 2ug |
Accessions: | BC002324 |
Gene id: | 29928 |
Gene description: | translocase of inner mitochondrial membrane 22 homolog (yeast) |
Synonyms: | TEX4; TIM22; mitochondrial import inner membrane translocase subunit Tim22; testis-expressed sequence 4; translocase of inner mitochondrial membrane 22 homolog; translocase of inner mitochondrial membrane 22 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcggcggccgcccccaatgccggaggctcggcccctgagacagcgggttccgccgaagctccgctgcagtacagcctgctcctgcagtacctggtgggtgacaagcgtcagccccggctcctggagcctgggagcctgggcgggatcccaagtccagccaagagtgaggagcagaagatgatcgagaaggcgatggaaagctgcgctttcaaggctgcgctggcctgcgtgggaggatttgtcttaggaggtgcatttggggtgtttaccgctggcatcgataccaacgtgggctttgaccctaaggatccttaccgtacaccgactgcaaaagaagtgctgaaagacatggggcagagaggaatgtcctatgccaaaaatttcgccattgtgggagccatgttttcttgtactgagtgtttgatagaatcttaccggggaacatcagactggaagaacagtgtcatcagtggctgcatcacgggaggagctattggtttcagagctggcttaaaggctggggccattggttgtggaggttttgctgctttctctgctgcgattgattattacctccggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like - transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) - heat shock protein 90kDa alpha (cytosolic), class B member 1 - dysbindin (dystrobrevin binding protein 1) domain containing 2 |