Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TIMM22-translocase of inner mitochondrial membrane 22 homolog (yeast) Gene
PTXBC002324
New product
Data sheet of TIMM22-translocase of inner mitochondrial membrane 22 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM22-translocase of inner mitochondrial membrane 22 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002324 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM22 |
| Origin species: | Human |
| Product name: | TIMM22-translocase of inner mitochondrial membrane 22 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC002324 |
| Gene id: | 29928 |
| Gene description: | translocase of inner mitochondrial membrane 22 homolog (yeast) |
| Synonyms: | TEX4; TIM22; mitochondrial import inner membrane translocase subunit Tim22; testis-expressed sequence 4; translocase of inner mitochondrial membrane 22 homolog; translocase of inner mitochondrial membrane 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggccgcccccaatgccggaggctcggcccctgagacagcgggttccgccgaagctccgctgcagtacagcctgctcctgcagtacctggtgggtgacaagcgtcagccccggctcctggagcctgggagcctgggcgggatcccaagtccagccaagagtgaggagcagaagatgatcgagaaggcgatggaaagctgcgctttcaaggctgcgctggcctgcgtgggaggatttgtcttaggaggtgcatttggggtgtttaccgctggcatcgataccaacgtgggctttgaccctaaggatccttaccgtacaccgactgcaaaagaagtgctgaaagacatggggcagagaggaatgtcctatgccaaaaatttcgccattgtgggagccatgttttcttgtactgagtgtttgatagaatcttaccggggaacatcagactggaagaacagtgtcatcagtggctgcatcacgggaggagctattggtttcagagctggcttaaaggctggggccattggttgtggaggttttgctgctttctctgctgcgattgattattacctccggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like - transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) - heat shock protein 90kDa alpha (cytosolic), class B member 1 - dysbindin (dystrobrevin binding protein 1) domain containing 2 |