Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene
PTXBC001105
New product
Data sheet of DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001105 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DBNDD2 |
| Origin species: | Human |
| Product name: | DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC001105 |
| Gene id: | 55861 |
| Gene description: | dysbindin (dystrobrevin binding protein 1) domain containing 2 |
| Synonyms: | C20orf35; CK1BP; HSMNP1; dysbindin domain-containing protein 2; SCF apoptosis response protein 1; casein kinase-1 binding protein; dysbindin (dystrobrevin binding protein 1) domain containing 2; dysbindin domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccaaatcctcgggccgccctggagcgccagcagctccgccttcgggagcggcaaaaattcttcgaggacattttacagccagagacagagtttgtctttcctctgtcccatctgcatctcgagtcgcagagaccccccataggtagtatctcatccatggaagtgaatgtggacacactggagcaagtagaacttattgaccttggggacccggatgcagcagatgtgttcttgccttgcgaagatcctccaccaaccccccagtcgtctggggtggacaaccatttggaggagctgagcctgccggtgcctacatcagacaggaccacatctaggacctcctcctcctcctcctccgactcctccaccaacctgcatagcccaaatccaagtgatgatggagcagatacgcccttggcacagtcggatgaagaggaggaaaggggtgatggaggggcagagcctggagcctgcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - single-strand-selective monofunctional uracil-DNA glycosylase 1 - heat shock protein 90kDa alpha (cytosolic), class A member 1 - eukaryotic translation elongation factor 1 delta pseudogene 3 - translocase of outer mitochondrial membrane 22 homolog (yeast) |