Login to display prices
Login to display prices
DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene View larger

DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene

PTXBC001105

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001105
Product type: DNA & cDNA
Ncbi symbol: DBNDD2
Origin species: Human
Product name: DBNDD2-dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene
Size: 2ug
Accessions: BC001105
Gene id: 55861
Gene description: dysbindin (dystrobrevin binding protein 1) domain containing 2
Synonyms: C20orf35; CK1BP; HSMNP1; dysbindin domain-containing protein 2; SCF apoptosis response protein 1; casein kinase-1 binding protein; dysbindin (dystrobrevin binding protein 1) domain containing 2; dysbindin domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacccaaatcctcgggccgccctggagcgccagcagctccgccttcgggagcggcaaaaattcttcgaggacattttacagccagagacagagtttgtctttcctctgtcccatctgcatctcgagtcgcagagaccccccataggtagtatctcatccatggaagtgaatgtggacacactggagcaagtagaacttattgaccttggggacccggatgcagcagatgtgttcttgccttgcgaagatcctccaccaaccccccagtcgtctggggtggacaaccatttggaggagctgagcctgccggtgcctacatcagacaggaccacatctaggacctcctcctcctcctcctccgactcctccaccaacctgcatagcccaaatccaagtgatgatggagcagatacgcccttggcacagtcggatgaagaggaggaaaggggtgatggaggggcagagcctggagcctgcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - single-strand-selective monofunctional uracil-DNA glycosylase 1
- heat shock protein 90kDa alpha (cytosolic), class A member 1
- eukaryotic translation elongation factor 1 delta pseudogene 3
- translocase of outer mitochondrial membrane 22 homolog (yeast)