Login to display prices
Login to display prices
SMUG1-single-strand-selective monofunctional uracil-DNA glycosylase 1 Gene View larger

SMUG1-single-strand-selective monofunctional uracil-DNA glycosylase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMUG1-single-strand-selective monofunctional uracil-DNA glycosylase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SMUG1-single-strand-selective monofunctional uracil-DNA glycosylase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000417
Product type: DNA & cDNA
Ncbi symbol: SMUG1
Origin species: Human
Product name: SMUG1-single-strand-selective monofunctional uracil-DNA glycosylase 1 Gene
Size: 2ug
Accessions: BC000417
Gene id: 23583
Gene description: single-strand-selective monofunctional uracil-DNA glycosylase 1
Synonyms: FDG; HMUDG; UNG3; single-strand selective monofunctional uracil DNA glycosylase; single-strand-selective monofunctional uracil-DNA glycosylase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccaggctttcctgctggggtccatccatgagcctgcaggtgccctcatggagccccagccctgccctggaagcttggctgagagcttcctggaggaggagcttcggctcaatgctgagctgagccagctgcagttttcggagcctgtgggcatcatctacaatcccgtggagtatgcatgggagccacatcgcaactacgtgactcgctactgccagggccccaaggaagtactcttcctgggcatgaaccctggaccttttggcatggcccagactggggtgccctttggggaagtaagcatggtccgggactggttgggcattgtggggcctgtgctgacccctccccaagagcatcctaaacgaccagtgctgggactggagtgcccacagtcagaaggaccaagacaaagcatgggacatgaaattaagagtgaacttcttatgggaggctgcagctggatcagaggaaaaatccagtgtgacagagtgcaagtcagaagacctggcttttcatcccagctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heat shock protein 90kDa alpha (cytosolic), class A member 1
- eukaryotic translation elongation factor 1 delta pseudogene 3
- translocase of outer mitochondrial membrane 22 homolog (yeast)
- v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)